Stem-loop sequence mmu-mir-101b

Accession

MI0000649 (change log)

Symbol

MGI:Mir101b

Description

Mus musculus miR-101b stem-loop

Gene family

MIPF0000046; mir-101

Literature search

114 open access papers mention mmu-mir-101b
(820 sentences)

Stem-loop

   aucugagac  -a      c                  accgau      g  c 
5'          ug  acugcc uuuuucgguuaucauggu      gcugua cu u
            ||  |||||| ||||||||||||||||||      |||||| || g
3'          ac  uggcgg aagaagucgauaguguca      ugacau ga a
   -------cu  cg      u                  ------      g  a 

Deep sequencing

2397819 reads, 3.29e+03 reads per million, 125 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000648) -- expression in mouse was verified independently [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr19: 29135279-29135375 [+]
• Overlapping transcripts:

  sense

  ENSMUST00000064393 ; Rcl1-201; intron 8

Database links

• EntrezGene:Mir101b
• MGI:Mir101b
• RNAcentral:URS000075D396_10090
• miRBase Tracker:MI0000649

Mature sequence mmu-miR-101b-5p

• Accession: MIMAT0017046
• Previous IDs: mmu-miR-101b*
• Sequence: 24 - ucgguuaucaugguaccgaugcu - 46
• Deep sequencing: 56 reads, 31 experiments
• Evidence: experimental; Illumina [5]
• Database links:
  • RNAcentral:URS00003D948A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-101b-5p
  • miRDB:mmu-miR-101b-5p

Mature sequence mmu-miR-101b-3p

• Accession: MIMAT0000616
• Previous IDs: mmu-miR-101b
• Sequence: 60 - guacaguacugugauagcu - 78
• Deep sequencing: 2397696 reads, 126 experiments
• Evidence: experimental; cloned [2-3], Illumina [4-5]
• Database links:
  • RNAcentral:URS0000762B8A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-101b-3p.1
  • miRDB:mmu-miR-101b-3p
  • microrna.org:mmu-miR-101b-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).