![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-101b |
|||||
Accession | MI0000649 (change log) | ||||
Symbol | MGI:Mir101b | ||||
Description | Mus musculus miR-101b stem-loop | ||||
Gene family | MIPF0000046; mir-101 | ||||
Literature search |
![]()
114 open access papers mention mmu-mir-101b | ||||
Stem-loop |
aucugagac -a c accgau g c 5' ug acugcc uuuuucgguuaucauggu gcugua cu u || |||||| |||||||||||||||||| |||||| || g 3' ac uggcgg aagaagucgauaguguca ugacau ga a -------cu cg u ------ g a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000648) -- expression in mouse was verified independently [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-101b-5p |
|
Accession | MIMAT0017046 |
Previous IDs | mmu-miR-101b* |
Sequence |
24 - ucgguuaucaugguaccgaugcu - 46 |
Deep sequencing | 56 reads, 31 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-101b-3p |
|
Accession | MIMAT0000616 |
Previous IDs | mmu-miR-101b |
Sequence |
60 - guacaguacugugauagcu - 78 |
Deep sequencing | 2397696 reads, 126 experiments |
Evidence | experimental; cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|