Hsa-mir-200c is a microRNA implicated in the regulation of gene expression through its interaction with the 3′ untranslated regions (3′UTRs) of target mRNAs [PMC2133370]. Research has identified the 3′UTR of glutathione S-transferase mu 3 (GSTM3) as a direct target of hsa-mir-200c, as evidenced by experiments involving co-transfection with scrambled control siRNA and various GSTM3 3′UTR plasmids [PMC9688189]. Clinical data further suggest that hsa-mir-200c levels may have prognostic significance, with patients exhibiting lower expression levels of this microRNA having a longer average survival period by approximately 12 months compared to those with higher expression levels [PMC2133370]. This correlation between hsa-mir-200c expression and patient survival underscores the potential importance of this microRNA in disease progression and patient outcomes.
c - - A U u ggu ccuC GUC UUACCC GCAGUGUU GGg gc u |||| ||| |||||| |||||||| ||| || ggAG UAG AAUGGG CGUCAUAA cuc ug g - G U C U - agg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004657 |
| Description | Homo sapiens hsa-miR-200c-5p mature miRNA |
| Sequence | 5 - CGUCUUACCCAGCAGUGUUUGG - 26 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000617 |
| Description | Homo sapiens hsa-miR-200c-3p mature miRNA |
| Sequence | 44 - UAAUACUGCCGGGUAAUGAUGGA - 66 |
| Evidence |
experimental
cloned [1-4], Northern [2] |
| Database links |
|
| Predicted targets |
|
|