![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR166f |
|||||
Accession | MI0000675 (change log) | ||||
Description | Oryza sativa miR166f stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
70 open access papers mention osa-MIR166f | ||||
Stem-loop |
- cauc a uc c a a gu 5' cgau uuguugag ggaaug gucugg cugagaucgu ccac gug g |||| |||||||| |||||| |||||| |||||||||| |||| ||| g 3' gcug aacaacuc ccuuac cggacc ggcucuggca ggug cac g g -cuc c uu a - - au |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The stem-loop sequence represented here is predicted based on homology to miRNAs cloned from Arabidopsis [1]. Its expression has not been verified in rice. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR166f |
|
Accession | MIMAT0000640 |
Sequence |
72 - ucggaccaggcuucauucccc - 92 |
Deep sequencing | 36912 reads, 2 experiments |
Evidence | by similarity; MI0000201 |
Database links |
|
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|