Stem-loop sequence hsa-mir-155

Accession

MI0000681 (change log)

Symbol

HGNC:MIR155

Description

Homo sapiens miR-155 stem-loop

Gene family

MIPF0000157; mir-155

Literature search

1009 open access papers mention hsa-mir-155
(8229 sentences)

Stem-loop

                 c   a        -u   c 
5' cuguuaaugcuaau gug uagggguu  uug c
   |||||||||||||| ||| ||||||||  |||  
3' gacaauuacgauua uac auccucag  aac u
                 -   -        uc   c 

Deep sequencing

177884 reads, 356 reads per million, 149 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Human mir-155 is predicted based on homology to a cloned miR from mouse (MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr21: 25573980-25574044 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR155
• HGNC:MIR155
• RNAcentral:URS000062749E_9606
• miRBase Tracker:MI0000681

Mature sequence hsa-miR-155-5p

• Accession: MIMAT0000646
• Previous IDs: hsa-miR-155
• Sequence: 4 - uuaaugcuaaucgugauagggguu - 27
• Deep sequencing: 177692 reads, 149 experiments
• Evidence: experimental; cloned [2,5-7]
• Database links:
  • RNAcentral:URS0000338542_9606
• Predicted targets:
  • TargetMiner:hsa-miR-155-5p
  • TargetScanVert:hsa-miR-155-5p
  • miRDB:hsa-miR-155-5p
  • microrna.org:hsa-miR-155-5p

Mature sequence hsa-miR-155-3p

• Accession: MIMAT0004658
• Previous IDs: hsa-miR-155*
• Sequence: 43 - cuccuacauauuagcauuaaca - 64
• Deep sequencing: 192 reads, 28 experiments
• Evidence: experimental; cloned [5]
• Database links:
  • RNAcentral:URS000034309A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-155-3p
  • TargetScanVert:hsa-miR-155-3p
  • miRDB:hsa-miR-155-3p
  • microrna.org:hsa-miR-155-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:15738415 "Accumulation of miR-155 and BIC RNA in human B cell lymphomas" Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE Proc Natl Acad Sci U S A. 102:3627-3632(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7. PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).