![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-155 |
|||||
Accession | MI0000681 (change log) | ||||
Symbol | HGNC:MIR155 | ||||
Description | Homo sapiens miR-155 stem-loop | ||||
Gene family | MIPF0000157; mir-155 | ||||
Literature search |
![]()
1009 open access papers mention hsa-mir-155 | ||||
Stem-loop |
c a -u c 5' cuguuaaugcuaau gug uagggguu uug c |||||||||||||| ||| |||||||| ||| 3' gacaauuacgauua uac auccucag aac u - - uc c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Human mir-155 is predicted based on homology to a cloned miR from mouse (MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-155-5p |
|
Accession | MIMAT0000646 |
Previous IDs | hsa-miR-155 |
Sequence |
4 - uuaaugcuaaucgugauagggguu - 27 |
Deep sequencing | 177692 reads, 149 experiments |
Evidence | experimental; cloned [2,5-7] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-155-3p |
|
Accession | MIMAT0004658 |
Previous IDs | hsa-miR-155* |
Sequence |
43 - cuccuacauauuagcauuaaca - 64 |
Deep sequencing | 192 reads, 28 experiments |
Evidence | experimental; cloned [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 |
PMID:15738415
"Accumulation of miR-155 and BIC RNA in human B cell lymphomas"
Proc Natl Acad Sci U S A. 102:3627-3632(2005).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
7 |