Stem-loop sequence mmu-mir-10a

AccessionMI0000685
Previous IDsmmu-mir-10a-1
Symbol MGI:Mir10a
DescriptionMus musculus miR-10a stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----gacc   --c    uu        a    g     c          uaaggaa 
5'          ugu   uguc  cuguauau cccu uagau cgaauuugug       u
            |||   ||||  |||||||| |||| ||||| ||||||||||        
3'          aca   acag  gauguaua gggg aucua gcuuaaacac       u
   acucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
2155786 reads, 3.34e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 96317165-96317274 [+]
sense
OTTMUST00000003562 ; Hoxb4-001; 3'UTR (exon 1)
ENSMUST00000049241 ; Hoxb4-001; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-10a-5p

Accession MIMAT0000648
Previous IDsmmu-miR-10a
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing227216 reads, 89 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-10a-3p

Accession MIMAT0004659
Previous IDsmmu-miR-10a*
Sequence

63 - 

caaauucguaucuaggggaaua

 - 84

Get sequence
Deep sequencing3149 reads, 71 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).