Stem-loop sequence mmu-mir-19a

Accession MI0000688
Symbol MGI:Mir19a
Description Mus musculus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There maybe 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    c  u                 --      ---    ag 
gcag cc cuguuaguuuugcauag  uugcac   uaca  a
|||| || |||||||||||||||||  ||||||   ||||  a
cguc gg gguagucaaaacguauc  aacgug   augu  g
    c  u                 ua      uug    aa 
Get sequence
Deep sequencing
1289049 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr14: 115044000-115044081 [+]
sense
OTTMUST00000083388 ; Mirhg1-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-19a
mmu-mir-17 chr14: 115043671-115043754 [+]
mmu-mir-18a chr14: 115043851-115043946 [+]
mmu-mir-19a chr14: 115044000-115044081 [+]
mmu-mir-20a chr14: 115044157-115044263 [+]
mmu-mir-19b-1 chr14: 115044305-115044391 [+]
mmu-mir-92a-1 chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-19a-5p

Accession MIMAT0004660
Previous IDs mmu-miR-19a*
Sequence

13 - 

uaguuuugcauaguugcacuac

 - 34

Get sequence
Deep sequencing 512 reads, 49 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-19a-3p

Accession MIMAT0000651
Previous IDs mmu-miR-19a
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing 253091 reads, 82 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).