![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-19a |
||||||||||||||
Accession | MI0000688 (change log) | |||||||||||||
Symbol | MGI:Mir19a | |||||||||||||
Description | Mus musculus miR-19a stem-loop | |||||||||||||
Gene family | MIPF0000011; mir-19 | |||||||||||||
Literature search |
![]()
140 open access papers mention mmu-mir-19a | |||||||||||||
Stem-loop |
c u -- --- ag 5' gcag cc cuguuaguuuugcauag uugcac uaca a |||| || ||||||||||||||||| |||||| |||| a 3' cguc gg gguagucaaaacguauc aacgug augu g c u ua uug aa |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence mmu-miR-19a-5p |
|
Accession | MIMAT0004660 |
Previous IDs | mmu-miR-19a* |
Sequence |
13 - uaguuuugcauaguugcacuac - 34 |
Deep sequencing | 748 reads, 58 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-19a-3p |
|
Accession | MIMAT0000651 |
Previous IDs | mmu-miR-19a |
Sequence |
49 - ugugcaaaucuaugcaaaacuga - 71 |
Deep sequencing | 316334 reads, 107 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|