Mmu-mir-25 is a microRNA that is part of the miR-106b~25 cluster, which also includes mmu-miR-106b and mmu-miR-93, and is located within the 13th intron of the MCM7 gene [PMC7803573]. It has been identified as one of the miRNAs with a regulatory role in mice, with its expression being upregulated in diet-induced obesity (DIO) mice that were subsequently fed a low-fat diet (LFD) [PMC4571067]. Additionally, mmu-mir-25 has been found to be prominent in regulatory networks due to its high degree of connectivity [PMC3692539]. Its expression is also notably high during superovulation processes in mice [PMC4499447]. Research has shown that overexpression of mmu-mir-25 can significantly enhance induced pluripotent stem cell (iPSC) generation, while its knockdown decreases reprogramming efficiency [PMC8946776]. Furthermore, inhibition of mmu-mir-25 can lead to increased levels of reactive oxygen species and overexpression of Nox4 [PMC8914318]'>PMC8914318], while a decrease in its expression has been observed in mice with diabetic peripheral neuropathy [PMC8914318]. These findings suggest that mmu-mir-25 plays a multifaceted role in physiological processes and disease states.
 
                                a      ag    G     UU G     UG    acg 
ggcc guguug  AGGC GAGAC  G GCAAU  Cugg   c
|||| ||||||  |||| |||||  | |||||  ||||    
ccgg cgugac  UCUG CUCUG  C CGUUA  gguc   u
    c      AG    G     UU A     Cg    ccg 
            | Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Accession | MIMAT0017049 | 
| Description | Mus musculus mmu-miR-25-5p mature miRNA | 
| Sequence | 14 - AGGCGGAGACUUGGGCAAUUGC - 35 | 
| Evidence | experimental 454 [6], Illumina [7] | 
| Database links |       | 
| Predicted targets |     | 
| Accession | MIMAT0000652 | 
| Description | Mus musculus mmu-miR-25-3p mature miRNA | 
| Sequence | 52 - CAUUGCACUUGUCUCGGUCUGA - 73 | 
| Evidence | experimental cloned [2,4], Illumina [5,7] | 
| Database links |       | 
| Predicted targets |     | 
| 
 |