![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-32 |
|||||
Accession | MI0000691 (change log) | ||||
Symbol | MGI:Mir32 | ||||
Description | Mus musculus miR-32 stem-loop | ||||
Gene family | MIPF0000069; mir-32 | ||||
Literature search |
![]()
40 open access papers mention mmu-mir-32 | ||||
Stem-loop |
ug u - uu c 5' ggagauau cacau acuaaguugcau g gu a |||||||| ||||| |||||||||||| | || 3' cuuuuaua gugug ugauuuaacgua c cg c gu - a uc g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Mouse mir-32 is predicted [3] based on homology to a cloned miR from human (MI0000090) [1]. Its expression in mouse was later independently verified [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-32-5p |
|
Accession | MIMAT0000654 |
Previous IDs | mmu-miR-32 |
Sequence |
6 - uauugcacauuacuaaguugca - 27 |
Deep sequencing | 15268 reads, 105 experiments |
Evidence | experimental; cloned [2,4], Illumina [5,7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-32-3p |
|
Accession | MIMAT0017050 |
Previous IDs | mmu-miR-32* |
Sequence |
47 - caauuuagugugugugauauu - 67 |
Deep sequencing | 601 reads, 75 experiments |
Evidence | experimental; 454 [6], Illumina [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|