Stem-loop sequence mmu-mir-32

Accession

MI0000691 (change log)

Symbol

MGI:Mir32

Description

Mus musculus miR-32 stem-loop

Gene family

MIPF0000069; mir-32

Literature search

40 open access papers mention mmu-mir-32
(373 sentences)

Stem-loop

           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 

Deep sequencing

16031 reads, 69.5 reads per million, 105 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse mir-32 is predicted [3] based on homology to a cloned miR from human (MI0000090) [1]. Its expression in mouse was later independently verified [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr4: 56895229-56895298 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000016919 ; Tmem245-003; intron 8

  OTTMUST00000016920 ; Tmem245-004; intron 12

  OTTMUST00000016917 ; Tmem245-001; intron 14

  OTTMUST00000016918 ; Tmem245-002; intron 14

  ENSMUST00000132816 ; Tmem245-003; intron 8

  ENSMUST00000125082 ; Tmem245-004; intron 12

  ENSMUST00000068792 ; Tmem245-001; intron 14

  ENSMUST00000155625 ; Tmem245-002; intron 14

  ENSMUST00000107609 ; Tmem245-201; intron 14

Database links

• EntrezGene:Mirn32
• MGI:Mir32
• RNAcentral:URS0000472EB8_10090
• miRBase Tracker:MI0000691

Mature sequence mmu-miR-32-5p

• Accession: MIMAT0000654
• Previous IDs: mmu-miR-32
• Sequence: 6 - uauugcacauuacuaaguugca - 27
• Deep sequencing: 15268 reads, 105 experiments
• Evidence: experimental; cloned [2,4], Illumina [5,7]
• Database links:
  • RNAcentral:URS00004C47FB_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-32-5p
  • miRDB:mmu-miR-32-5p
  • microrna.org:mmu-miR-32-5p

Mature sequence mmu-miR-32-3p

• Accession: MIMAT0017050
• Previous IDs: mmu-miR-32*
• Sequence: 47 - caauuuagugugugugauauu - 67
• Deep sequencing: 601 reads, 75 experiments
• Evidence: experimental; 454 [6], Illumina [7]
• Database links:
  • RNAcentral:URS000039DEB8_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-32-3p
  • miRDB:mmu-miR-32-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).