![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-100 |
||||||
Accession | MI0000692 (change log) | |||||
Symbol | MGI:Mir100 | |||||
Description | Mus musculus miR-100 stem-loop | |||||
Gene family | MIPF0000033; mir-10 | |||||
Literature search |
![]()
75 open access papers mention mmu-mir-100 | |||||
Stem-loop |
-uu c a cg uc a c au 5' ccug g caca acc uaga cga cuugug ug u |||| | |||| ||| |||| ||| |||||| || 3' ggau c gugu ugg aucu guu gaacac ac c ugu u a au gu c - gu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MI0000102) [1]. Its expression was later verified in mouse [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-100-5p |
|
Accession | MIMAT0000655 |
Previous IDs | mmu-miR-100 |
Sequence |
13 - aacccguagauccgaacuugug - 34 |
Deep sequencing | 2016377 reads, 107 experiments |
Evidence | experimental; cloned [3], Illumina [4,6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-100-3p |
|
Accession | MIMAT0017051 |
Previous IDs | mmu-miR-100* |
Sequence |
47 - acaagcuugugucuauagguau - 68 |
Deep sequencing | 981 reads, 57 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|