Stem-loop sequence mmu-mir-210

Accession

MI0000695 (change log)

Symbol

MGI:Mir210

Description

Mus musculus miR-210 stem-loop

Gene family

MIPF0000086; mir-210

Literature search

121 open access papers mention mmu-mir-210
(1255 sentences)

Stem-loop

   cc  gg -a  cc u     cu    a     a   cc   -      c  c   gc 
5'   gg  c  gu  c ccagg  cagg cagcc cug  cac cgcaca ug guu  u
     ||  |  ||  | |||||  |||| ||||| |||  ||| |||||| || |||   
3'   cc  g  cg  g ggucc  gucu gucgg gac  gug gcgugu ac cag  c
   --  aa cg  ac -     cu    a     c   -a   u      c  c   gc 

Deep sequencing

104812 reads, 254 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MI0000286) [1]. Its expression in mouse was later verified independently [2,4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr7: 141221384-141221493 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn210
• MGI:Mir210
• RNAcentral:URS000075B4CE_10090
• miRBase Tracker:MI0000695

Mature sequence mmu-miR-210-5p

• Accession: MIMAT0017052
• Previous IDs: mmu-miR-210*
• Sequence: 28 - agccacugcccaccgcacacug - 49
• Deep sequencing: 3410 reads, 82 experiments
• Evidence: experimental; 454 [6], Illumina [7]
• Database links:
  • RNAcentral:URS00004BD12B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-210-5p
  • miRDB:mmu-miR-210-5p

Mature sequence mmu-miR-210-3p

• Accession: MIMAT0000658
• Previous IDs: mmu-miR-210
• Sequence: 66 - cugugcgugugacagcggcuga - 87
• Deep sequencing: 101347 reads, 107 experiments
• Evidence: experimental; cloned [2,4], Illumina [5,7]
• Database links:
  • RNAcentral:URS000055128B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-210-3p
  • miRDB:mmu-miR-210-3p
  • microrna.org:mmu-miR-210-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).