![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-210 |
|||||
Accession | MI0000695 (change log) | ||||
Symbol | MGI:Mir210 | ||||
Description | Mus musculus miR-210 stem-loop | ||||
Gene family | MIPF0000086; mir-210 | ||||
Literature search |
![]()
121 open access papers mention mmu-mir-210 | ||||
Stem-loop |
cc gg -a cc u cu a a cc - c c gc 5' gg c gu c ccagg cagg cagcc cug cac cgcaca ug guu u || | || | ||||| |||| ||||| ||| ||| |||||| || ||| 3' cc g cg g ggucc gucu gucgg gac gug gcgugu ac cag c -- aa cg ac - cu a c -a u c c gc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MI0000286) [1]. Its expression in mouse was later verified independently [2,4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-210-5p |
|
Accession | MIMAT0017052 |
Previous IDs | mmu-miR-210* |
Sequence |
28 - agccacugcccaccgcacacug - 49 |
Deep sequencing | 3410 reads, 82 experiments |
Evidence | experimental; 454 [6], Illumina [7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-210-3p |
|
Accession | MIMAT0000658 |
Previous IDs | mmu-miR-210 |
Sequence |
66 - cugugcgugugacagcggcuga - 87 |
Deep sequencing | 101347 reads, 107 experiments |
Evidence | experimental; cloned [2,4], Illumina [5,7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|