Stem-loop sequence mmu-mir-210

AccessionMI0000695
Symbol MGI:Mir210
DescriptionMus musculus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cc  gg -a  cc u     cu    a     a   cc   -      c  c   gc 
5'   gg  c  gu  c ccagg  cagg cagcc cug  cac cgcaca ug guu  u
     ||  |  ||  | |||||  |||| ||||| |||  ||| |||||| || |||   
3'   cc  g  cg  g ggucc  gucu gucgg gac  gug gcgugu ac cag  c
   --  aa cg  ac -     cu    a     c   -a   u      c  c   gc 
Get sequence
Deep sequencing
107000 reads, 413 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MI0000286) [1]. Its expression in mouse was later verified independently [2,4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 141221384-141221493 [-]
intergenic
Database links

Mature sequence mmu-miR-210-5p

Accession MIMAT0017052
Previous IDsmmu-miR-210*
Sequence

28 - 

agccacugcccaccgcacacug

 - 49

Get sequence
Deep sequencing1062 reads, 60 experiments
Evidence experimental; 454 [6], Illumina [7]
Predicted targets

Mature sequence mmu-miR-210-3p

Accession MIMAT0000658
Previous IDsmmu-miR-210
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing76290 reads, 90 experiments
Evidence experimental; cloned [2,4], Illumina [5,7]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).