Stem-loop sequence mmu-mir-212

AccessionMI0000696
Symbol MGI:Mir212
DescriptionMus musculus miR-212 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       -  c   c   -ca  u     cu      c      ccc  g 
5' gggc ag gcg cgg   cc uggcu  agacug uuacug   gg c
   |||| || ||| |||   || |||||  |||||| ||||||   ||  
3' cccg uc cgc gcc   gg acuga  ucugac aaugac   cc c
       g  -   a   acc  c     cc      -      -uu  g 
Get sequence
Deep sequencing
31882 reads, 139 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 75173388-75173478 [+]
sense
OTTMUST00000013960 ; RP23-143A14.3-001; intron 1
ENSMUST00000134252 ; 1700016P03Rik-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-212
mmu-mir-212chr11: 75173388-75173478 [+]
mmu-mir-132chr11: 75173682-75173747 [+]
Database links

Mature sequence mmu-miR-212-5p

Accession MIMAT0017053
Sequence

16 - 

accuuggcucuagacugcuuacu

 - 38

Get sequence
Deep sequencing14053 reads, 78 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence mmu-miR-212-3p

Accession MIMAT0000659
Previous IDsmmu-miR-212
Sequence

56 - 

uaacagucuccagucacggcca

 - 77

Get sequence
Deep sequencing6087 reads, 72 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).