Stem-loop sequence mmu-mir-216a

AccessionMI0000699
Previous IDsmmu-mir-216
Symbol MGI:Mir216a
DescriptionMus musculus miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   u    u         cu   a        --   uc 
5'  uggu uaaucucag  ggc acugugag  aug  c
    |||| |||||||||  ||| ||||||||  |||  c
3'  aucg auuaggguc  cug ugacacuc  uac  u
   a    u         -u   g        cu   ua 
Get sequence
Deep sequencing
105223 reads, 33.3 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-216 is predicted [2] based on homology to a reported miR from human (MI0000292) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 28757012-28757083 [+]
sense
OTTMUST00000011841 ; RP23-298H6.1-001; intron 2
ENSMUST00000138164 ; Gm12082-001; intron 2
Clustered miRNAs
< 10kb from mmu-mir-216a
mmu-mir-216achr11: 28757012-28757083 [+]
mmu-mir-217chr11: 28763728-28763835 [+]
Database links

Mature sequence mmu-miR-216a-5p

Accession MIMAT0000662
Previous IDsmmu-miR-216;mmu-miR-216a
Sequence

7 - 

uaaucucagcuggcaacuguga

 - 28

Get sequence
Deep sequencing874 reads, 25 experiments
Evidence experimental; cloned [3], Illumina [4]
Validated targets
Predicted targets

Mature sequence mmu-miR-216a-3p

Accession MIMAT0017054
Previous IDsmmu-miR-216a*
Sequence

47 - 

cacaguggucucugggauuaug

 - 68

Get sequence
Deep sequencing336 reads, 8 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).