Stem-loop sequence mmu-mir-223

AccessionMI0000703
Symbol MGI:Mir223
DescriptionMus musculus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-223. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology MicroRNA-223 (miR-223) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-223 is a hematopoietic specific microRNA with crucial functions in myeloid lineage development. It plays an essential role in promoting granulocytic differentiation while also being associated with the suppression of erythrocytic differentiation. miR-223 is commonly repressed in hepatocellular carcinoma and leukemia. Higher expression levels of miRNA-223 are associated with extranodal marginal-zone lymphoma of mucosa-associated lymphoid tissue of the stomach and recurrent ovarian cancer. In some cancers the microRNA-223 down-regulation is correlated with higher tumor burden, disease aggressiveness, and poor prognostic factors. MicroRNA-223 is also associated with rheumatoid arthritis, sepsis, type 2 diabetes, and hepatic ischemia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    ccaucu   -gu        cc u              gaguug         u 
5'  cugg      gca   gucacgcu  g guauuugacaagcu      gacacucug g
    ||||      |||   ||||||||  | ||||||||||||||      ||||||||| u
3'  gacu      cgu   cgguguga  c cauaaacuguuuga      cugugagau g
   -    ---auc   acu        ac c              ------         g 
Get sequence
Deep sequencing
532026 reads, 2.04e+03 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-223 is predicted [2] based on homology to a reported miR from human (MI0000300) [1]. Its expression was later verified by cloning [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 96242817-96242926 [+]
sense
OTTMUST00000044608 ; RP23-23B17.2-002; exon 2
OTTMUST00000044607 ; RP23-23B17.2-001; exon 3
ENSMUST00000147681 ; F630028O10Rik-002; exon 2
ENSMUST00000133125 ; F630028O10Rik-001; exon 3
Database links

Mature sequence mmu-miR-223-5p

Accession MIMAT0017056
Previous IDsmmu-miR-223*
Sequence

26 - 

cguguauuugacaagcugaguug

 - 48

Get sequence
Deep sequencing12437 reads, 68 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence mmu-miR-223-3p

Accession MIMAT0000665
Previous IDsmmu-miR-223
Sequence

68 - 

ugucaguuugucaaauacccca

 - 89

Get sequence
Deep sequencing506504 reads, 83 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).