Stem-loop sequence mmu-mir-320

Accession

MI0000704 (change log)

Symbol

MGI:Mir320

Description

Mus musculus miR-320 stem-loop

Gene family

MIPF0000163; mir-320

Literature search

59 open access papers mention mmu-mir-320
(226 sentences)

Stem-loop

   gccucg    --   ---c         uu       c      g 
5'       ccgc  ccu    cgccuucuc  cccgguu uucccg a
         ||||  |||    |||||||||  ||||||| ||||||  
3'       ggug  gga    gcgggagag  gggucga aagggc g
   -----g    ua   aaaa         uu       a      u 

Deep sequencing

1458842 reads, 3.84e+03 reads per million, 130 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse mir-320 is predicted [2] based on homology to a cloned miR from human (MI0000542) [1]. Its expression was later verified in mouse [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr14: 70443510-70443591 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn320
• MGI:Mir320
• RNAcentral:URS00006B1A8C_10090
• miRBase Tracker:MI0000704

Mature sequence mmu-miR-320-5p

• Accession: MIMAT0017057
• Previous IDs: mmu-miR-320*
• Sequence: 16 - gccuucucuucccgguucuucc - 37
• Deep sequencing: 82 reads, 46 experiments
• Evidence: experimental; Illumina [6]
• Database links:
  • RNAcentral:URS000042A57E_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-320-5p
  • miRDB:mmu-miR-320-5p

Mature sequence mmu-miR-320-3p

• Accession: MIMAT0000666
• Previous IDs: mmu-miR-320
• Sequence: 48 - aaaagcuggguugagagggcga - 69
• Deep sequencing: 1449024 reads, 107 experiments
• Evidence: experimental; cloned [3-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00003CF1AD_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-320-3p
  • miRDB:mmu-miR-320-3p
  • microrna.org:mmu-miR-320-3p

References

1. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).