Stem-loop sequence mmu-mir-320

AccessionMI0000704 (change log)
Symbol MGI:Mir320
DescriptionMus musculus miR-320 stem-loop
Gene family MIPF0000163; mir-320
Literature search

59 open access papers mention mmu-mir-320
(226 sentences)

Stem-loop
   gccucg    --   ---c         uu       c      g 
5'       ccgc  ccu    cgccuucuc  cccgguu uucccg a
         ||||  |||    |||||||||  ||||||| ||||||  
3'       ggug  gga    gcgggagag  gggucga aagggc g
   -----g    ua   aaaa         uu       a      u 
Get sequence
Deep sequencing
1458842 reads, 3.84e+03 reads per million, 130 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-320 is predicted [2] based on homology to a cloned miR from human (MI0000542) [1]. Its expression was later verified in mouse [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 70443510-70443591 [+]
intergenic
Database links

Mature sequence mmu-miR-320-5p

Accession MIMAT0017057
Previous IDsmmu-miR-320*
Sequence

16 - 

gccuucucuucccgguucuucc

 - 37

Get sequence
Deep sequencing82 reads, 46 experiments
Evidence experimental; Illumina [6]
Database links
Predicted targets

Mature sequence mmu-miR-320-3p

Accession MIMAT0000666
Previous IDsmmu-miR-320
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Deep sequencing1449024 reads, 107 experiments
Evidence experimental; cloned [3-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).