![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-320 |
|||||
Accession | MI0000704 (change log) | ||||
Symbol | MGI:Mir320 | ||||
Description | Mus musculus miR-320 stem-loop | ||||
Gene family | MIPF0000163; mir-320 | ||||
Literature search |
![]()
59 open access papers mention mmu-mir-320 | ||||
Stem-loop |
gccucg -- ---c uu c g 5' ccgc ccu cgccuucuc cccgguu uucccg a |||| ||| ||||||||| ||||||| |||||| 3' ggug gga gcgggagag gggucga aagggc g -----g ua aaaa uu a u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Mouse mir-320 is predicted [2] based on homology to a cloned miR from human (MI0000542) [1]. Its expression was later verified in mouse [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-320-5p |
|
Accession | MIMAT0017057 |
Previous IDs | mmu-miR-320* |
Sequence |
16 - gccuucucuucccgguucuucc - 37 |
Deep sequencing | 82 reads, 46 experiments |
Evidence | experimental; Illumina [6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-320-3p |
|
Accession | MIMAT0000666 |
Previous IDs | mmu-miR-320 |
Sequence |
48 - aaaagcuggguugagagggcga - 69 |
Deep sequencing | 1449024 reads, 107 experiments |
Evidence | experimental; cloned [3-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|