miRBase entry: mmu-mir-26a-2

Stem-loop mmu-mir-26a-2


Accession
MI0000706
Symbol
MGI: Mir26a-2
Description
Mus musculus mmu-mir-26a-2 precursor miRNA mir-26
Gene
family?
RF00244; mir-26

Literature search
188 open access papers mention mmu-mir-26a-2
(2048 sentences)

Sequence

2946186 reads, 8735 reads per million, 107 experiments
ggcugcggcuggaUUCAAGUAAUCCAGGAUAGGCUguguccguccaugaggCCUGUUCUUGAUUACUUGUUUCuggaggcagcg
.(((((..(((((..(((((((((.(((((((((((((......)))..)))))))))).)))))))))..)))))..))))).

Structure
g     gg     UU         C          --   uc 
 gcugc  cugga  CAAGUAAUC AGGAUAGGCU  gug  c
 |||||  |||||  ||||||||| ||||||||||  |||   
 cgacg  gguCU  GUUCAUUAG UCUUGUCCgg  uac  g
g     ga     UU         U          ag   cu 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This sequence is a second predicted hairpin precursor for miR-26a (MIR:MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr10: 126995530-126995613 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-26a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-26a-5p

Accession MIMAT0000533
Description Mus musculus mmu-miR-26a-5p mature miRNA
Sequence 14 - UUCAAGUAAUCCAGGAUAGGCU - 35
Evidence experimental
cloned [1-2,4-5], Illumina [6,8]
Database links
Predicted targets

Mature mmu-miR-26a-2-3p

Accession MIMAT0017058
Description Mus musculus mmu-miR-26a-2-3p mature miRNA
Sequence 52 - CCUGUUCUUGAUUACUUGUUUC - 73
Evidence experimental
454 [7], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  8. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275