Stem-loop sequence mmu-mir-211

AccessionMI0000708 (change log)
Symbol MGI:Mir211
DescriptionMus musculus miR-211 stem-loop
Gene family MIPF0000042; mir-204
Literature search

44 open access papers mention mmu-mir-211
(490 sentences)

Stem-loop 
   -    -u    ccu      ug               ca     u    ag  cu 
5'  cugc  ugga   gugacc  ugggcuucccuuugu  uccuu gccu  gc  c
    ||||  ||||   ||||||  |||||||||||||||  ||||| ||||  ||   
3'  gacg  aucu   cacugg  acucggggggaaacg  aggaa cgga  ug  u
   a    uc    --c      ug               ac     -    -g  ag
Get sequence
Deep sequencing
27332 reads, 74.1 reads per million, 81 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-211 is predicted [2] based on homology to a reported miR from human (MI0000287) [1]. Its expression has not been verified in mouse. The mature miR differs from the human sequence at a single base. This sequence maps to mouse chromosome 7.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 64205806-64205911 [+]
sense
OTTMUST00000110483 ; Trpm1-022; intron 1
OTTMUST00000110481 ; Trpm1-018; intron 2
OTTMUST00000054160 ; Trpm1-004; intron 4
OTTMUST00000054165 ; Trpm1-009; intron 5
OTTMUST00000054159 ; Trpm1-003; intron 6
OTTMUST00000054158 ; Trpm1-002; intron 6
OTTMUST00000054157 ; Trpm1-001; intron 6
OTTMUST00000054162 ; Trpm1-006; intron 6
OTTMUST00000054163 ; Trpm1-007; intron 6
OTTMUST00000054161 ; Trpm1-005; intron 6
OTTMUST00000054164 ; Trpm1-008; intron 6
ENSMUST00000176548 ; Trpm1-022; intron 1
ENSMUST00000176392 ; Trpm1-018; intron 2
ENSMUST00000107527 ; Trpm1-004; intron 4
ENSMUST00000107515 ; Trpm1-009; intron 5
ENSMUST00000085222 ; Trpm1-003; intron 6
ENSMUST00000153421 ; Trpm1-002; intron 6
ENSMUST00000107525 ; Trpm1-001; intron 6
ENSMUST00000141574 ; Trpm1-006; intron 6
ENSMUST00000107516 ; Trpm1-007; intron 6
ENSMUST00000107519 ; Trpm1-005; intron 6
ENSMUST00000032737 ; Trpm1-008; intron 6
ENSMUST00000177102 ; Trpm1-201; intron 6
Database links

Mature sequence mmu-miR-211-5p

Accession MIMAT0000668
Previous IDsmmu-miR-211
Sequence

26 -  

uucccuuugucauccuuugccu

 - 47

Get sequence
Deep sequencing27076 reads, 76 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-211-3p

Accession MIMAT0017059
Previous IDsmmu-miR-211*
Sequence

63 -  

gcaaggacagcaaaggggggc

 - 83

Get sequence
Deep sequencing250 reads, 23 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).