Stem-loop sequence mmu-mir-211

Accession

MI0000708 (change log)

Symbol

MGI:Mir211

Description

Mus musculus miR-211 stem-loop

Gene family

MIPF0000042; mir-204

Stem-loop

   -    -u    ccu      ug               ca     u    ag  cu 
5'  cugc  ugga   gugacc  ugggcuucccuuugu  uccuu gccu  gc  c
    ||||  ||||   ||||||  |||||||||||||||  ||||| ||||  ||   
3'  gacg  aucu   cacugg  acucggggggaaacg  aggaa cgga  ug  u
   a    uc    --c      ug               ac     -    -g  ag 

Deep sequencing

5328 reads, 32.1 reads per million, 56 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mouse mir-211 is predicted [2] based on homology to a reported miR from human (MI0000287) [1]. Its expression has not been verified in mouse. The mature miR differs from the human sequence at a single base. This sequence maps to mouse chromosome 7.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr7: 64205806-64205911 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000110483 ; Trpm1-022; intron 1

  OTTMUST00000110481 ; Trpm1-018; intron 2

  OTTMUST00000054160 ; Trpm1-004; intron 4

  OTTMUST00000054165 ; Trpm1-009; intron 5

  OTTMUST00000054159 ; Trpm1-003; intron 6

  OTTMUST00000054158 ; Trpm1-002; intron 6

  OTTMUST00000054157 ; Trpm1-001; intron 6

  OTTMUST00000054162 ; Trpm1-006; intron 6

  OTTMUST00000054163 ; Trpm1-007; intron 6

  OTTMUST00000054161 ; Trpm1-005; intron 6

  OTTMUST00000054164 ; Trpm1-008; intron 6

  ENSMUST00000176548 ; Trpm1-022; intron 1

  ENSMUST00000176392 ; Trpm1-018; intron 2

  ENSMUST00000107527 ; Trpm1-004; intron 4

  ENSMUST00000107515 ; Trpm1-009; intron 5

  ENSMUST00000085222 ; Trpm1-003; intron 6

  ENSMUST00000153421 ; Trpm1-002; intron 6

  ENSMUST00000107525 ; Trpm1-001; intron 6

  ENSMUST00000141574 ; Trpm1-006; intron 6

  ENSMUST00000107516 ; Trpm1-007; intron 6

  ENSMUST00000107519 ; Trpm1-005; intron 6

  ENSMUST00000032737 ; Trpm1-008; intron 6

  ENSMUST00000177102 ; Trpm1-201; intron 6

Database links

• EntrezGene:Mirn211
• MGI:Mir211
• RNAcentral:URS0000759DBA_10090
• miRBase Tracker:MI0000708

Mature sequence mmu-miR-211-5p

• Accession: MIMAT0000668
• Previous IDs: mmu-miR-211
• Sequence: 26 - uucccuuugucauccuuugccu - 47
• Deep sequencing: 5078 reads, 51 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS00003138EF_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-211-5p
  • miRDB:mmu-miR-211-5p
  • microrna.org:mmu-miR-211-5p

Mature sequence mmu-miR-211-3p

• Accession: MIMAT0017059
• Previous IDs: mmu-miR-211*
• Sequence: 63 - gcaaggacagcaaaggggggc - 83
• Deep sequencing: 247 reads, 20 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS000028F5B7_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-211-3p
  • miRDB:mmu-miR-211-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).