|
miRBase |
|
Stem-loop sequence mmu-mir-222 |
||||||
| Accession | MI0000710 | |||||
| Symbol | MGI:Mir222 | |||||
| Description | Mus musculus miR-222 stem-loop | |||||
| Gene family | MIPF0000051; mir-221 | |||||
| Stem-loop |
- c u - auc ucuu cc ucag ggcucaguagccag uguag cug u || |||| |||||||||||||| ||||| ||| g gg gguc cugggucaucgguc acauc gac g c u u u gac uaau |
|||||
| Deep sequencing |
| |||||
| Comments |
Mouse mir-222 is predicted [2] based on homology to a reported miR from human (MI0000299 ) [1]. Its expression was later verified in mouse by cloning [3]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence mmu-miR-222-5p |
|
| Accession | MIMAT0017061 |
| Previous IDs | mmu-miR-222* |
| Sequence |
12 - ucaguagccaguguagauccu - 32 |
| Deep sequencing | 1073 reads, 62 experiments |
| Evidence | experimental; 454 [5], Solexa [6] |
| Predicted targets |
|
Mature sequence mmu-miR-222-3p |
|
| Accession | MIMAT0000670 |
| Previous IDs | mmu-miR-222 |
| Sequence |
49 - agcuacaucuggcuacugggu - 69 |
| Deep sequencing | 438476 reads, 82 experiments |
| Evidence | experimental; cloned [3], Solexa [4,6] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
| 2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|