Stem-loop sequence mmu-mir-222

Accession MI0000710
Symbol MGI:Mir222
Description Mus musculus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
-  c    u              -     auc   ucuu 
 cc ucag ggcucaguagccag uguag   cug    u
 || |||| |||||||||||||| |||||   |||    g
 gg gguc cugggucaucgguc acauc   gac    g
c  u    u              u     gac   uaau 
Get sequence
Deep sequencing
1345471 reads, 97 experiments
Comments

Mouse mir-222 is predicted [2] based on homology to a reported miR from human (MI0000299 ) [1]. Its expression was later verified in mouse by cloning [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 19146893-19146971 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-222
mmu-mir-222 chrX: 19146893-19146971 [-]
mmu-mir-221 chrX: 19146294-19146388 [-]
Database links

Mature sequence mmu-miR-222-5p

Accession MIMAT0017061
Previous IDs mmu-miR-222*
Sequence

12 - 

ucaguagccaguguagauccu

 - 32

Get sequence
Deep sequencing 1073 reads, 62 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

Mature sequence mmu-miR-222-3p

Accession MIMAT0000670
Previous IDs mmu-miR-222
Sequence

49 - 

agcuacaucuggcuacugggu

 - 69

Get sequence
Deep sequencing 438476 reads, 82 experiments
Evidence experimental; cloned [3], Solexa [4,6]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).