Stem-loop sequence mmu-mir-199a-2

AccessionMI0000713
Symbol MGI:Mir199a-2
DescriptionMus musculus miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uggaa   uca  aga    -    c   gcc       u        c   --uca  ac 
5'      gcu   gg   uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        |||   ||   |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga   cc   ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   ---  ---    a    u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
2476491 reads, 1.47e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 162217814-162217923 [+]
sense
OTTMUST00000073023 ; Dnm3os-001; exon 1
ENSMUST00000139662 ; Dnm3os-001; exon 1
ENSMUST00000178978 ; Dnm3os-201; exon 1
antisense
OTTMUST00000073178 ; Dnm3-003; intron 3
OTTMUST00000073179 ; Dnm3-004; intron 3
OTTMUST00000073026 ; Dnm3-006; intron 14
OTTMUST00000073176 ; Dnm3-001; intron 14
ENSMUST00000160665 ; Dnm3-004; intron 3
ENSMUST00000159763 ; Dnm3-003; intron 3
ENSMUST00000070330 ; Dnm3-006; intron 14
ENSMUST00000086074 ; Dnm3-001; intron 14
Clustered miRNAs
< 10kb from mmu-mir-199a-2
mmu-mir-199a-2chr1: 162217814-162217923 [+]
mmu-mir-214chr1: 162223368-162223477 [+]
Database links

Mature sequence mmu-miR-199a-5p

Accession MIMAT0000229
Previous IDsmmu-miR-199a
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Deep sequencing310543 reads, 72 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Validated targets
Predicted targets

Mature sequence mmu-miR-199a-3p

Accession MIMAT0000230
Previous IDsmmu-miR-199a*
Sequence

70 - 

acaguagucugcacauugguua

 - 91

Get sequence
Deep sequencing4305192 reads, 92 experiments
Evidence experimental; cloned [1,5], Illumina [6-7]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).