Stem-loop sequence mmu-mir-199a-2

Accession

MI0000713 (change log)

Symbol

MGI:Mir199a-2

Description

Mus musculus miR-199a-2 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

164 open access papers mention mmu-mir-199a-2
(1263 sentences)

Stem-loop

   uggaa   uca  aga    -    c   gcc       u        c   --uca  ac 
5'      gcu   gg   uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        |||   ||   |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga   cc   ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   ---  ---    a    u   auu       c        -   uguug  gu 

Deep sequencing

4162897 reads, 1.64e+04 reads per million, 110 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr1: 162217814-162217923 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000073023 ; Dnm3os-001; exon 1

  ENSMUST00000139662 ; Dnm3os-001; exon 1

  ENSMUST00000178978 ; Dnm3os-201; exon 1

  antisense

  OTTMUST00000073178 ; Dnm3-003; intron 3

  OTTMUST00000073179 ; Dnm3-004; intron 3

  OTTMUST00000073026 ; Dnm3-006; intron 14

  OTTMUST00000073176 ; Dnm3-001; intron 14

  ENSMUST00000160665 ; Dnm3-004; intron 3

  ENSMUST00000159763 ; Dnm3-003; intron 3

  ENSMUST00000070330 ; Dnm3-006; intron 14

  ENSMUST00000086074 ; Dnm3-001; intron 14

Clustered miRNAs

< 10kb from mmu-mir-199a-2

• mmu-mir-199a-2: chr1: 162217814-162217923 [+]
• mmu-mir-214: chr1: 162223368-162223477 [+]

Database links

• EntrezGene:Mirn199a-2
• MGI:Mir199a-2
• RNAcentral:URS000075E3A2_10090
• miRBase Tracker:MI0000713

Mature sequence mmu-miR-199a-5p

• Accession: MIMAT0000229
• Previous IDs: mmu-miR-199a
• Sequence: 31 - cccaguguucagacuaccuguuc - 53
• Deep sequencing: 1057387 reads, 91 experiments
• Evidence: experimental; cloned [5], Illumina [6-7]
• Database links:
  • RNAcentral:URS0000554A4F_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-199a-5p
  • miRDB:mmu-miR-199a-5p
  • microrna.org:mmu-miR-199a-5p

Mature sequence mmu-miR-199a-3p

• Accession: MIMAT0000230
• Previous IDs: mmu-miR-199a*
• Sequence: 70 - acaguagucugcacauugguua - 91
• Deep sequencing: 7264843 reads, 106 experiments
• Evidence: experimental; cloned [1,5], Illumina [6-7]
• Database links:
  • RNAcentral:URS00003F2D94_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-199a-3p
  • miRDB:mmu-miR-199a-3p
  • microrna.org:mmu-miR-199a-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
4. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).