![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-199a-2 |
||||||
Accession | MI0000713 (change log) | |||||
Symbol | MGI:Mir199a-2 | |||||
Description | Mus musculus miR-199a-2 stem-loop | |||||
Gene family | MIPF0000040; mir-199 | |||||
Literature search |
![]()
164 open access papers mention mmu-mir-199a-2 | |||||
Stem-loop |
uggaa uca aga - c gcc u c --uca ac 5' gcu gg uccu gcuc guc ccagugu cagacuac ugu gg a ||| || |||| |||| ||| ||||||| |||||||| ||| || 3' cga cc ggga cggg cag gguuaca gucugaug aca cc a ----a --- --- a u auu c - uguug gu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-199a-5p |
|
Accession | MIMAT0000229 |
Previous IDs | mmu-miR-199a |
Sequence |
31 - cccaguguucagacuaccuguuc - 53 |
Deep sequencing | 1057387 reads, 91 experiments |
Evidence | experimental; cloned [5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-199a-3p |
|
Accession | MIMAT0000230 |
Previous IDs | mmu-miR-199a* |
Sequence |
70 - acaguagucugcacauugguua - 91 |
Deep sequencing | 7264843 reads, 106 experiments |
Evidence | experimental; cloned [1,5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
4 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|