Stem-loop sequence mmu-mir-135a-2

Accession MI0000715
Previous IDs mmu-mir-135-2
Symbol MGI:Mir135a-2
Description Mus musculus miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
a  uaaa     ucua   c            u            -u gua 
 ga    uucac    gug uuuauggcuuuu auuccuauguga  c   a
 ||    |||||    ||| |||||||||||| ||||||||||||  |    
 cu    aagug    cau aaguaccgaagg uagggauguacu  g   u
a  -uaa     -uua   a            -            cu aaa
Get sequence
Deep sequencing
200728 reads, 75 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr10: 92072086-92072185 [-]
intergenic
Database links

Mature sequence mmu-miR-135a-5p

Accession MIMAT0000147
Previous IDs mmu-miR-135a
Sequence

23 -  

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing 380933 reads, 58 experiments
Evidence experimental; cloned [1,3], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-135a-2-3p

Accession MIMAT0017064
Previous IDs mmu-miR-135a-2*
Sequence

62 -  

uguagggauggaagccaugaa

 - 82

Get sequence
Deep sequencing 2668 reads, 39 experiments
Evidence experimental; Solexa [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).