Stem-loop mmu-mir-19b-1

Accession

MI0000718

Symbol

MGI: Mir19b-1

Description

Mus musculus mmu-mir-19b-1 precursor miRNA mir-19

Gene
family

RF00245; mir-19

Literature search

136 open access papers mention mmu-mir-19b-1
(781 sentences)

Sequence

232703 reads, 2010 reads per million, 107 experiments

cacuggucuaugguuAGUUUUGCAGGUUUGCAUCCAGCuguauaauauucugcUGUGCAAAUCCAUGCAAAACUGAcugugguggug
((((...(((((((((((((((((((((((((..((((.............)))))))))).)).))))))))))))))))).))))

Structure

    ggu                 -  -      UC    uguau 
cacu   cuaugguuAGUUUUGCA GG UUUGCA  CAGC     a
||||   ||||||||||||||||| || ||||||  ||||     a
gugg   ggugucAGUCAAAACGU CC AAACGU  GUcg     u
    --u                 A  U      --    ucuua 

Annotation confidence High

Genome context

chr14: 115044305-115044391 [+]

Clustered miRNAs

5 other miRNAs are < 10 kb from mmu-mir-19b-1

Mature mmu-miR-19b-3p

• Accession: MIMAT0000513
• Description: Mus musculus mmu-miR-19b-3p mature miRNA
• Sequence: 54 - UGUGCAAAUCCAUGCAAAACUGA - 76
• Evidence: experimental ; cloned [1-3,5], Northern [2], Illumina [6,8]

Mature mmu-miR-19b-1-5p

• Accession: MIMAT0017065
• Description: Mus musculus mmu-miR-19b-1-5p mature miRNA
• Sequence: 16 - AGUUUUGCAGGUUUGCAUCCAGC - 38
• Evidence: experimental ; 454 [7], Illumina [8]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


7. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


8. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275