Stem-loop sequence mmu-mir-181c

AccessionMI0000724
Symbol MGI:Mir181c
DescriptionMus musculus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g   a  g       gaa        cu       a     ggca 
5'  cca gg uuugggg   cauucaac  gucggug guuug    g
    ||| || |||||||   ||||||||  ||||||| |||||    c
3'  ggu cc gagcccc   gugaguug  cagcuac caaac    u
   a   -  g       -ag        -c       -     agac 
Get sequence
Deep sequencing
110151 reads, 458 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-181c was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish and independently in mouse [2,3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 84178873-84178961 [-]
sense
ENSMUST00000083549 ; Mir181c-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-181c
mmu-mir-181cchr8: 84178873-84178961 [-]
mmu-mir-181dchr8: 84178716-84178787 [-]
Database links

Mature sequence mmu-miR-181c-5p

Accession MIMAT0000674
Previous IDsmmu-miR-181c
Sequence

17 - 

aacauucaaccugucggugagu

 - 38

Get sequence
Deep sequencing27686 reads, 86 experiments
Evidence experimental; cloned [2-3], Illumina [4,6]
Predicted targets

Mature sequence mmu-miR-181c-3p

Accession MIMAT0017068
Previous IDsmmu-miR-181c*
Sequence

56 - 

accaucgaccguugaguggacc

 - 77

Get sequence
Deep sequencing9551 reads, 84 experiments
Evidence experimental; 454 [5], Illumina [6]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).