Stem-loop sequence mmu-mir-125b-1

Accession

MI0000725 (change log)

Symbol

MGI:Mir125b-1

Description

Mus musculus miR-125b-1 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

258 open access papers mention mmu-mir-125b-1
(1456 sentences)

Stem-loop

   ugcgcuccccu   uc  ug   c           au     c 
5'            cag  cc  aga ccuaacuugug  guuua c
              |||  ||  ||| |||||||||||  ||||| g
3'            guc  gg  ucu ggauugggcac  uaaau u
   -----------   ga  gu   c           -c     u 

Deep sequencing

2303588 reads, 9.23e+03 reads per million, 117 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr9: 41581926-41582002 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000112036 ; RP23-442M18.1-002; intron 1

  OTTMUST00000112037 ; RP23-442M18.1-003; intron 1

  OTTMUST00000112038 ; RP23-442M18.1-004; intron 1

  OTTMUST00000112039 ; RP23-442M18.1-001; intron 1

  ENSMUST00000181214 ; 2610203C20Rik-002; intron 1

  ENSMUST00000180622 ; 2610203C20Rik-003; intron 1

  ENSMUST00000180818 ; 2610203C20Rik-004; intron 1

  ENSMUST00000181955 ; 2610203C20Rik-001; intron 1

  ENSMUST00000098868 ; 2610203C20Rik-201; intron 2

Database links

• EntrezGene:Mir125b-1
• MGI:Mir125b-1
• RNAcentral:URS000075F06E_10090
• Rfam:lin-4
• miRBase Tracker:MI0000725

Mature sequence mmu-miR-125b-5p

• Accession: MIMAT0000136
• Previous IDs: mmu-miR-125b
• Sequence: 15 - ucccugagacccuaacuuguga - 36
• Deep sequencing: 4485548 reads, 109 experiments
• Evidence: experimental; cloned [1,3-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS0000209905_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-125b-5p
  • miRDB:mmu-miR-125b-5p
  • microrna.org:mmu-miR-125b-5p

Mature sequence mmu-miR-125b-1-3p

• Accession: MIMAT0004669
• Previous IDs: mmu-miR-125b-3p
• Sequence: 55 - acggguuaggcucuugggagcu - 76
• Deep sequencing: 36083 reads, 79 experiments
• Evidence: experimental; cloned [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00002DABEA_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-125b-1-3p
  • miRDB:mmu-miR-125b-1-3p
  • microrna.org:mmu-miR-125b-1-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).