![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-125b-1 |
|||||
Accession | MI0000725 (change log) | ||||
Symbol | MGI:Mir125b-1 | ||||
Description | Mus musculus miR-125b-1 stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
![]()
258 open access papers mention mmu-mir-125b-1 | ||||
Stem-loop |
ugcgcuccccu uc ug c au c 5' cag cc aga ccuaacuugug guuua c ||| || ||| ||||||||||| ||||| g 3' guc gg ucu ggauugggcac uaaau u ----------- ga gu c -c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-125b-5p |
|
Accession | MIMAT0000136 |
Previous IDs | mmu-miR-125b |
Sequence |
15 - ucccugagacccuaacuuguga - 36 |
Deep sequencing | 4485548 reads, 109 experiments |
Evidence | experimental; cloned [1,3-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-125b-1-3p |
|
Accession | MIMAT0004669 |
Previous IDs | mmu-miR-125b-3p |
Sequence |
55 - acggguuaggcucuugggagcu - 76 |
Deep sequencing | 36083 reads, 79 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|