![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-7b |
|||||
Accession | MI0000730 (change log) | ||||
Symbol | MGI:Mir7b | ||||
Description | Mus musculus miR-7b stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
![]()
114 open access papers mention mmu-mir-7b | ||||
Stem-loop |
aggagcggaguacgu - g u aagac u c au 5' gag cca ugcuaug gg uugugauuu guuguu ug a ||| ||| ||||||| || ||||||||| |||||| || 3' cuc ggu gcgauac cc gacacugaa caacag au u -----uuccacuauc a - u -gacc - u ag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MI0000728) and mir-7-2 (MI0000729) in mouse, and mir-7-1 (MI0000263), mir-7-2 (MI0000264) and mir-7-3 (MI0000265) in human. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-7b-5p |
|
Accession | MIMAT0000678 |
Previous IDs | mmu-miR-7b |
Sequence |
30 - uggaagacuugugauuuuguuguu - 53 |
Deep sequencing | 170715 reads, 105 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-7b-3p |
|
Accession | MIMAT0017071 |
Previous IDs | mmu-miR-7b* |
Sequence |
68 - caacaagucacagccagccuca - 89 |
Deep sequencing | 238 reads, 13 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|