Stem-loop sequence mmu-mir-7b

Accession

MI0000730 (change log)

Symbol

MGI:Mir7b

Description

Mus musculus miR-7b stem-loop

Gene family

MIPF0000022; mir-7

Literature search

114 open access papers mention mmu-mir-7b
(977 sentences)

Stem-loop

   aggagcggaguacgu   -   g       u  aagac         u      c  au 
5'                gag cca ugcuaug gg     uugugauuu guuguu ug  a
                  ||| ||| ||||||| ||     ||||||||| |||||| ||   
3'                cuc ggu gcgauac cc     gacacugaa caacag au  u
   -----uuccacuauc   a   -       u  -gacc         -      u  ag 

Deep sequencing

170965 reads, 810 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MI0000728) and mir-7-2 (MI0000729) in mouse, and mir-7-1 (MI0000263), mir-7-2 (MI0000264) and mir-7-3 (MI0000265) in human.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr17: 56242988-56243098 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn7b
• MGI:Mir7b
• RNAcentral:URS000075AECB_10090
• Rfam:mir-7
• miRBase Tracker:MI0000730

Mature sequence mmu-miR-7b-5p

• Accession: MIMAT0000678
• Previous IDs: mmu-miR-7b
• Sequence: 30 - uggaagacuugugauuuuguuguu - 53
• Deep sequencing: 170715 reads, 105 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00002D98BC_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-7b-5p
  • miRDB:mmu-miR-7b-5p
  • microrna.org:mmu-miR-7b-5p

Mature sequence mmu-miR-7b-3p

• Accession: MIMAT0017071
• Previous IDs: mmu-miR-7b*
• Sequence: 68 - caacaagucacagccagccuca - 89
• Deep sequencing: 238 reads, 13 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS0000224ED9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-7b-3p
  • miRDB:mmu-miR-7b-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).