Stem-loop sequence mmu-mir-7b

Accession

MI0000730 (change log)

Symbol

MGI:Mir7b

Description

Mus musculus miR-7b stem-loop

Gene family

MIPF0000022; mir-7

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Stem-loop

   aggagcggaguacgu   -   g       u  aagac         u      c  au 
5'                gag cca ugcuaug gg     uugugauuu guuguu ug  a
                  ||| ||| ||||||| ||     ||||||||| |||||| ||   
3'                cuc ggu gcgauac cc     gacacugaa caacag au  u
   -----uuccacuauc   a   -       u  -gacc         -      u  ag 

Deep sequencing

143929 reads, 1.01e+03 reads per million, 75 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MI0000728) and mir-7-2 (MI0000729) in mouse, and mir-7-1 (MI0000263), mir-7-2 (MI0000264) and mir-7-3 (MI0000265) in human.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr17: 56242988-56243098 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn7b
• MGI:Mir7b
• RNAcentral:URS000075AECB_10090
• Rfam:mir-7
• miRBase Tracker:MI0000730

Mature sequence mmu-miR-7b-5p

• Accession: MIMAT0000678
• Previous IDs: mmu-miR-7b
• Sequence: 30 - uggaagacuugugauuuuguuguu - 53
• Deep sequencing: 143707 reads, 75 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00002D98BC_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-7b-5p
  • miRDB:mmu-miR-7b-5p
  • microrna.org:mmu-miR-7b-5p

Mature sequence mmu-miR-7b-3p

• Accession: MIMAT0017071
• Previous IDs: mmu-miR-7b*
• Sequence: 68 - caacaagucacagccagccuca - 89
• Deep sequencing: 217 reads, 9 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS0000224ED9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-7b-3p
  • miRDB:mmu-miR-7b-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).