Stem-loop sequence mmu-mir-7b

AccessionMI0000730
Symbol MGI:Mir7b
DescriptionMus musculus miR-7b stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aggagcggaguacgu   -   g       u  aagac         u      c  au 
5'                gag cca ugcuaug gg     uugugauuu guuguu ug  a
                  ||| ||| ||||||| ||     ||||||||| |||||| ||   
3'                cuc ggu gcgauac cc     gacacugaa caacag au  u
   -----uuccacuauc   a   -       u  -gacc         -      u  ag 
Get sequence
Deep sequencing
1103019 reads, 1.45e+03 reads per million, 106 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MI0000728) and mir-7-2 (MI0000729) in mouse, and mir-7-1 (MI0000263), mir-7-2 (MI0000264) and mir-7-3 (MI0000265) in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr17: 56242988-56243098 [+]
intergenic
Database links

Mature sequence mmu-miR-7b-5p

Accession MIMAT0000678
Previous IDsmmu-miR-7b
Sequence

30 - 

uggaagacuugugauuuuguugu

 - 52

Get sequence
Deep sequencing19304 reads, 48 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-7b-3p

Accession MIMAT0017071
Previous IDsmmu-miR-7b*
Sequence

68 - 

caacaagucacagccagccuca

 - 89

Get sequence
Deep sequencing312 reads, 9 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).