Stem-loop sequence mmu-mir-217

AccessionMI0000731
Symbol MGI:Mir217
DescriptionMus musculus miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   aaacauagucauuaca    uu       c  a  c     c         -cu    aag 
5'                 guuu  gauguug ag ua ugcau aggaacuga   ggau   a
                   ||||  ||||||| || || ||||| |||||||||   ||||    
3'                 caaa  cuacgac uc gu acgua uccuugacu   ccua   c
   --------------aa    -u       u  c  u     a         acc    auu 
Get sequence
Deep sequencing
97792 reads, 349 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational methods using conservation in with human, mouse and Fugu rubripes [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The mature mouse and human (MI0000293) sequences differ at a single position [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 28763728-28763835 [+]
sense
OTTMUST00000011841 ; RP23-298H6.1-001; intron 2
ENSMUST00000138164 ; Gm12082-001; intron 2
Clustered miRNAs
< 10kb from mmu-mir-217
mmu-mir-216achr11: 28757012-28757083 [+]
mmu-mir-217chr11: 28763728-28763835 [+]
Database links

Mature sequence mmu-miR-217-5p

Accession MIMAT0000679
Previous IDsmmu-miR-217
Sequence

34 - 

uacugcaucaggaacugacugga

 - 56

Get sequence
Deep sequencing52725 reads, 44 experiments
Evidence experimental; cloned [3], Illumina [4,6]
Validated targets
Predicted targets

Mature sequence mmu-miR-217-3p

Accession MIMAT0017072
Previous IDsmmu-miR-217*
Sequence

71 - 

caucaguuccuaaugcauugccu

 - 93

Get sequence
Deep sequencing172 reads, 9 experiments
Evidence experimental; 454 [5], Illumina [6]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).