miRBase entry: mmu-mir-217

Stem-loop mmu-mir-217


Accession
MI0000731
Symbol
MGI: Mir217
Description
Mus musculus mmu-mir-217 precursor miRNA
Gene family
MIPF0000077; mir-217

Literature search
34 open access papers mention mmu-mir-217
(230 sentences)

Sequence

52169 reads, 857 reads per million, 53 experiments
aaacauagucauuacaguuuuugauguugcagaUACUGCAUCAGGAACUGACUGGAuaagacuuaaucccCAUCAGUUCCUAAUGCAUUGCCUucagcaucuaaacaa
................((((..(((((((.((.((.(((((.(((((((((..((((........))))...))))))))).))))).)).)).))))))).))))..

Structure
aaacauagucauuaca    uu       c  a  C     C         -CU    aag 
                guuu  gauguug ag UA UGCAU AGGAACUGA   GGAu   a
                ||||  ||||||| || || ||||| |||||||||   ||||    
                caaa  cuacgac UC GU ACGUA UCCUUGACU   ccua   c
--------------aa    -u       u  C  U     A         ACc    auu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was predicted by computational methods using conservation in with human, mouse and Fugu rubripes [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The mature mouse and human (MIR:MI0000293) sequences differ at a single position [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [3].

Genome context
chr11: 28763728-28763835 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-217
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-217-5p

Accession MIMAT0000679
Description Mus musculus mmu-miR-217-5p mature miRNA
Sequence 34 - UACUGCAUCAGGAACUGACUGGA - 56
Evidence experimental
cloned [3], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-217-3p

Accession MIMAT0017072
Description Mus musculus mmu-miR-217-3p mature miRNA
Sequence 71 - CAUCAGUUCCUAAUGCAUUGCCU - 93
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275