Stem-loop sequence hsa-mir-194-2

AccessionMI0000732 (change log)
Symbol HGNC:MIR194-2
DescriptionHomo sapiens miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Literature search

142 open access papers mention hsa-mir-194-2
(1006 sentences)

Stem-loop
   -      c      cu         acuccauguggaagugc 
5'  ugguuc cgcccc  guaacagca                 c
    |||||| ||||||  |||||||||                  
3'  accggg gcgggg  uauugucgu                 c
   g      a      uc         cggggugaccuugguca 
Get sequence
Deep sequencing
106868 reads, 155 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236) on chromosome 1, and mir-194-2 (MI0000733) on chromosome 19) and human (mir-194-1 (MI0000488) on chromosome 1, and mir-194-2 (MI0000732) on chromosome 11).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 64891355-64891439 [-]
sense
OTTHUMT00000385272 ; SYVN1-012; intron 1
ENST00000530451 ; SYVN1-012; intron 1
antisense
OTTHUMT00000385288 ; MRPL49-002; intron 1
OTTHUMT00000385289 ; MRPL49-007; intron 1
OTTHUMT00000385290 ; MRPL49-008; intron 1
OTTHUMT00000385291 ; MRPL49-004; intron 1
OTTHUMT00000385292 ; MRPL49-006; intron 1
OTTHUMT00000385293 ; MRPL49-001; intron 1
OTTHUMT00000385294 ; MRPL49-009; intron 1
OTTHUMT00000385295 ; MRPL49-005; intron 1
ENST00000524482 ; MRPL49-002; intron 1
ENST00000528529 ; MRPL49-007; intron 1
ENST00000534078 ; MRPL49-008; intron 1
ENST00000526319 ; MRPL49-004; intron 1
ENST00000526171 ; MRPL49-006; intron 1
ENST00000279242 ; MRPL49-001; intron 1
ENST00000531705 ; MRPL49-009; intron 1
ENST00000533943 ; MRPL49-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-194-2
hsa-mir-6750chr11: 64898363-64898437 [-]
hsa-mir-194-2chr11: 64891355-64891439 [-]
hsa-mir-192chr11: 64891137-64891246 [-]
Database links

Mature sequence hsa-miR-194-5p

Accession MIMAT0000460
Previous IDshsa-miR-194
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing215327 reads, 154 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-194-3p

Accession MIMAT0004671
Previous IDshsa-miR-194*
Sequence

51 - 

ccaguggggcugcuguuaucug

 - 72

Get sequence
Deep sequencing836 reads, 47 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).