Stem-loop sequence mmu-mir-194-2

AccessionMI0000733 (change log)
Symbol MGI:Mir194-2
DescriptionMus musculus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Literature search

56 open access papers mention mmu-mir-194-2
(238 sentences)

Stem-loop
   g     c       cu         acuccauguggaagugc 
5'  uggcu ccacccu  guaacagca                 c
    ||||| |||||||  |||||||||                  
3'  aucgg ggugggg  uauugucgu                 c
   g     c       uc         cggggugaccuugguca 
Get sequence
Deep sequencing
207459 reads, 957 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana cloned miR-194 from mouse kidney tissue [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236) on chromosome 1, and mir-194-2 (MI0000733) on chromosome 19) and human (mir-194-1 (MI0000488) on chromosome 1, and mir-194-2 (MI0000732) on chromosome 11).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 6264643-6264728 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-194-2
mmu-mir-194-2chr19: 6264643-6264728 [+]
mmu-mir-192chr19: 6264844-6264932 [+]
Database links

Mature sequence mmu-miR-194-5p

Accession MIMAT0000224
Previous IDsmmu-miR-194
Sequence

16 - 

uguaacagcaacuccaugugga

 - 37

Get sequence
Deep sequencing408152 reads, 104 experiments
Evidence experimental; cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-194-2-3p

Accession MIMAT0017073
Previous IDsmmu-miR-194-2*
Sequence

52 - 

ccaguggggcugcuguuaucug

 - 73

Get sequence
Deep sequencing2922 reads, 76 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).