Stem-loop sequence mmu-mir-194-2

Accession MI0000733
Symbol MGI:Mir194-2
Description Mus musculus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
g     c       cu         a      g    agu   c 
 uggcu ccacccu  guaacagca cuccau ugga   gcc a
 ||||| |||||||  ||||||||| |||||| ||||   |||  
 aucgg ggugggg  uauugucgu ggggug accu   ugg c
g     c       uc         c      -    ---   u
Get sequence
Deep sequencing
263463 reads, 97 experiments
Comments

Lagos-Quintana cloned miR-194 from mouse kidney tissue [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236 ) on chromosome 1, and mir-194-2 (MI0000733 ) on chromosome 19) and human (mir-194-1 (MI0000488 ) on chromosome 1, and mir-194-2 (MI0000732 ) on chromosome 11).

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr19: 6264643-6264728 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-194-2
mmu-mir-194-2 chr19: 6264643-6264728 [+]
mmu-mir-192 chr19: 6264844-6264932 [+]
Database links

Mature sequence mmu-miR-194-5p

Accession MIMAT0000224
Previous IDs mmu-miR-194
Sequence

16 -  

uguaacagcaacuccaugugga

 - 37

Get sequence
Deep sequencing 488641 reads, 82 experiments
Evidence experimental; cloned [1,3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-194-2-3p

Accession MIMAT0017073
Previous IDs mmu-miR-194-2*
Sequence

52 -  

ccaguggggcugcuguuaucug

 - 73

Get sequence
Deep sequencing 249 reads, 56 experiments
Evidence experimental; Solexa [5]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).