Stem-loop sequence hsa-mir-200a

Accession MI0000737
Symbol HGNC:MIR200A
Description Homo sapiens miR-200a stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    - c   g        -            -----------     a 
 cggg c ccu ugagcauc uuaccggacagu           gcugg u
 |||| | ||| |||||||| ||||||||||||           ||||| u
 gccc g gga acuuguag aauggucuguca           cgacc u
c    a u   a        c            caaucucaguu     c 
Get sequence
Deep sequencing
523 reads, 40 experiments
Comments

miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 1103243-1103332 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-200a
hsa-mir-200b chr1: 1102484-1102578 [+]
hsa-mir-200a chr1: 1103243-1103332 [+]
hsa-mir-429 chr1: 1104385-1104467 [+]
Database links

Mature sequence hsa-miR-200a-5p

Accession MIMAT0001620
Previous IDs hsa-miR-200a*
Sequence

16 - 

caucuuaccggacagugcugga

 - 37

Get sequence
Deep sequencing 92 reads, 12 experiments
Evidence experimental; cloned [3-4]
Predicted targets

Mature sequence hsa-miR-200a-3p

Accession MIMAT0000682
Previous IDs hsa-miR-200a
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Deep sequencing 430 reads, 29 experiments
Evidence experimental; cloned [3-5]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).