![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-101-2 |
|||||
Accession | MI0000739 (change log) | ||||
Symbol | HGNC:MIR101-2 | ||||
Description | Homo sapiens miR-101-2 stem-loop | ||||
Gene family | MIPF0000046; mir-101 | ||||
Literature search |
![]()
307 open access papers mention hsa-mir-101-2 | ||||
Stem-loop |
ug c c a guaua 5' ac uc uuuuucgguuaucaugguac g ugcu u || || |||||||||||||||||||| | |||| 3' ug gg aagaagucaauagugucaug c augg c gu u a - aaagu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MI0000103) and 9 (MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-101-2-5p |
|
Accession | MIMAT0037312 |
Sequence |
12 - ucgguuaucaugguaccgaugc - 33 |
Deep sequencing | 150 reads, 49 experiments |
Evidence | not experimental |
Mature sequence hsa-miR-101-3p |
|
Accession | MIMAT0000099 |
Previous IDs | hsa-miR-101 |
Sequence |
49 - uacaguacugugauaacugaa - 69 |
Deep sequencing | 6029564 reads, 159 experiments |
Evidence | experimental; cloned [1-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|