Stem-loop sequence hsa-mir-101-2

AccessionMI0000739 (change log)
Symbol HGNC:MIR101-2
DescriptionHomo sapiens miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Literature search

307 open access papers mention hsa-mir-101-2
(2233 sentences)

Stem-loop 
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucaugguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     c
     gu  u                    a -    aaagu
Get sequence
Deep sequencing
3029409 reads, 6.08e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MI0000103) and 9 (MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 4850297-4850375 [+]
sense
OTTHUMT00000051588 ; RCL1-002; intron 4
OTTHUMT00000051592 ; RCL1-006; intron 4
OTTHUMT00000051589 ; RCL1-003; intron 7
OTTHUMT00000051587 ; RCL1-001; intron 8
ENST00000362195 ; MIR101-2-201; exon 1
ENST00000381730 ; RCL1-002; intron 4
ENST00000381728 ; RCL1-006; intron 4
ENST00000448872 ; RCL1-201; intron 4
ENST00000442869 ; RCL1-003; intron 7
ENST00000381750 ; RCL1-001; intron 8
Database links

Mature sequence hsa-miR-101-2-5p

Accession MIMAT0037312
Sequence

12 -  

ucgguuaucaugguaccgaugc

 - 33

Get sequence
Deep sequencing150 reads, 49 experiments
Evidence not experimental

Mature sequence hsa-miR-101-3p

Accession MIMAT0000099
Previous IDshsa-miR-101
Sequence

49 -  

uacaguacugugauaacugaa

 - 69

Get sequence
Deep sequencing6029564 reads, 159 experiments
Evidence experimental; cloned [1-4]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).