Stem-loop sequence hsa-mir-219a-2

AccessionMI0000740
Symbol HGNC:MIR219-2
DescriptionHomo sapiens miR-219a-2 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag cggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
126661 reads, 1.04e+03 reads per million, 36 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MI0000296) and mir-219-2 on chromosome 9 (MI0000740) [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 128392618-128392714 [-]
sense
OTTHUMT00000054088 ; MAPKAP1-005; intron 1
OTTHUMT00000355310 ; MAPKAP1-017; intron 1
OTTHUMT00000054096 ; MAPKAP1-013; intron 2
OTTHUMT00000355307 ; MAPKAP1-014; intron 2
OTTHUMT00000054094 ; MAPKAP1-011; intron 2
OTTHUMT00000054092 ; MAPKAP1-009; intron 3
OTTHUMT00000054091 ; MAPKAP1-008; intron 3
OTTHUMT00000355308 ; MAPKAP1-015; intron 4
OTTHUMT00000054090 ; MAPKAP1-007; intron 4
OTTHUMT00000054086 ; MAPKAP1-003; intron 4
ENST00000420643 ; MAPKAP1-005; intron 1
ENST00000473837 ; MAPKAP1-017; intron 1
ENST00000373497 ; MAPKAP1-202; intron 1
ENST00000427078 ; MAPKAP1-013; intron 2
ENST00000468896 ; MAPKAP1-014; intron 2
ENST00000448439 ; MAPKAP1-011; intron 2
ENST00000394063 ; MAPKAP1-203; intron 2
ENST00000373498 ; MAPKAP1-009; intron 3
ENST00000373503 ; MAPKAP1-008; intron 3
ENST00000373511 ; MAPKAP1-015; intron 4
ENST00000350766 ; MAPKAP1-007; intron 4
ENST00000394060 ; MAPKAP1-003; intron 4
ENST00000265960 ; MAPKAP1-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-219a-2
hsa-mir-219bchr9: 128392621-128392708 [+]
hsa-mir-219a-2chr9: 128392618-128392714 [-]
Database links

Mature sequence hsa-miR-219a-5p

Accession MIMAT0000276
Previous IDshsa-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing60 reads, 23 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-219a-2-3p

Accession MIMAT0004675
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing130 reads, 5 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).