Stem-loop sequence mmu-mir-219a-2

AccessionMI0000741
Symbol MGI:Mir219-2
DescriptionMus musculus miR-219a-2 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag uggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
63961 reads, 451 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 29845631-29845727 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-219a-2
mmu-mir-219bchr2: 29845647-29845711 [+]
mmu-mir-219a-2chr2: 29845631-29845727 [-]
Database links

Mature sequence mmu-miR-219a-5p

Accession MIMAT0000664
Previous IDsmmu-miR-219
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing38338 reads, 82 experiments
Evidence experimental; Illumina [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-219a-2-3p

Accession MIMAT0022841
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing14904 reads, 37 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).