Stem-loop sequence hsa-mir-296

Accession

MI0000747

Symbol

HGNC:MIR296

Description

Homo sapiens miR-296 stem-loop

Gene family

MIPF0000159; mir-296

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-296. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-296 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-296 has been named an "angiomiR" due to being characterised as a microRNA which regulates angiogenesis, the process of growth and creation of new blood vessels. miR-296 is thought to have a specific role in cancer in promoting tumour angiogenesis. It achieves this by targeting HGS mRNA, reducing its expression in endothelial cells which then results in greater number of VEGF receptors. miR-296 has predicted target sites in the transcription factor NANOG and may also contribute to carcinogenesis by dysregulating p53.

Stem-loop

  ga      ca       c  c         g   ugc 
ag  cccuuc  gagggcc cc cucaauccu uug   c
||  ||||||  ||||||| || ||||||||| |||   u
uc  gggaag  cucucgg gg ggguuggga gac   a
  uc      uc       a  u         -   uua 

Deep sequencing

756 reads, 17 experiments

Comments

This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells [1,3]. Its expression has also been verified in human ES cells [2].

Genome context

• Coordinates (GRCh37.p5): chr20: 57392670-57392749 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-296

• hsa-mir-298: chr20: 57393281-57393368 [-]
• hsa-mir-296: chr20: 57392670-57392749 [-]

Database links

• ENTREZGENE: 407022;MIR296
• HGNC: 31617;MIR296

Mature sequence hsa-miR-296-5p

• Accession: MIMAT0000690
• Previous IDs: hsa-miR-296
• Sequence: 14 - agggcccccccucaauccugu - 34
• Deep sequencing: 230 reads, 13 experiments
• Evidence: experimental; cloned [2,4-5]
• Validated targets:
  • MIRECORDS:hsa-miR-296-5p
  • MIRTARBASE:hsa-miR-296-5p
  • TARBASE:hsa-miR-296-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-296-5p
  • MICRORNA.ORG:hsa-miR-296-5p
  • MIRDB:hsa-miR-296-5p
  • RNA22-HSA:hsa-miR-296-5p
  • TARGETMINER:hsa-miR-296-5p
  • TARGETSCAN-VERT:hsa-miR-296-5p
  • PICTAR-VERT:hsa-miR-296

Mature sequence hsa-miR-296-3p

• Accession: MIMAT0004679
• Sequence: 48 - gaggguuggguggaggcucucc - 69
• Deep sequencing: 526 reads, 15 experiments
• Evidence: experimental; cloned [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-296-3p
  • MICRORNA.ORG:hsa-miR-296-3p
  • MIRDB:hsa-miR-296-3p
  • RNA22-HSA:hsa-miR-296-3p
  • TARGETMINER:hsa-miR-296-3p
  • TARGETSCAN-VERT:hsa-miR-296-3p
  • PICTAR-VERT:hsa-miR-296

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).