Stem-loop sequence hsa-mir-130b

Accession MI0000748
Symbol HGNC:MIR130B
Description Homo sapiens miR-130b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      c    ca       cc         a  --a   g 
ggccug ccga  cucuuuc  uguugcacu cu   uag c
|||||| ||||  |||||||  ||||||||| ||   |||  
cuggac ggcu  gggaaag  guaacguga ga   guc c
      u    ac       ua         c  agg   g 
Get sequence
Deep sequencing
8753 reads, 30 experiments
Comments

This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells [1,2]. Its expression was later verified in human BC-1 cells [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr22: 22007593-22007674 [+]
sense
OTTHUMT00000102312 ; PPIL2-002; exon 2
OTTHUMT00000102312 ; PPIL2-002; exon 2
OTTHUMT00000102312 ; PPIL2-002; exon 2
ENST00000498589 ; PPIL2-002; exon 2
ENST00000498589 ; PPIL2-002; exon 2
ENST00000498589 ; PPIL2-002; exon 2
Clustered miRNAs
< 10kb from hsa-mir-130b
hsa-mir-301b chr22: 22007270-22007347 [+]
hsa-mir-130b chr22: 22007593-22007674 [+]
Database links

Mature sequence hsa-miR-130b-5p

Accession MIMAT0004680
Previous IDs hsa-miR-130b*
Sequence

13 - 

acucuuucccuguugcacuac

 - 33

Get sequence
Deep sequencing 95 reads, 13 experiments
Evidence experimental; cloned [4-5]
Predicted targets

Mature sequence hsa-miR-130b-3p

Accession MIMAT0000691
Previous IDs hsa-miR-130b
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Deep sequencing 8656 reads, 30 experiments
Evidence experimental; cloned [3-5]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).