Stem-loop sequence hsa-mir-130b

Accession

MI0000748

Symbol

HGNC:MIR130B

Description

Homo sapiens miR-130b stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

      c    ca       cc         a  --a   g 
ggccug ccga  cucuuuc  uguugcacu cu   uag c
|||||| ||||  |||||||  ||||||||| ||   |||  
cuggac ggcu  gggaaag  guaacguga ga   guc c
      u    ac       ua         c  agg   g 

Deep sequencing

8753 reads, 30 experiments

Comments

This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells [1,2]. Its expression was later verified in human BC-1 cells [3].

Genome context

• Coordinates (GRCh37.p5): chr22: 22007593-22007674 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000102312 ; PPIL2-002; exon 2

  OTTHUMT00000102312 ; PPIL2-002; exon 2

  OTTHUMT00000102312 ; PPIL2-002; exon 2

  ENST00000498589 ; PPIL2-002; exon 2

  ENST00000498589 ; PPIL2-002; exon 2

  ENST00000498589 ; PPIL2-002; exon 2

Clustered miRNAs

< 10kb from hsa-mir-130b

• hsa-mir-301b: chr22: 22007270-22007347 [+]
• hsa-mir-130b: chr22: 22007593-22007674 [+]

Database links

• ENTREZGENE: 406920;MIR130B
• HGNC: 31515;MIR130B

Mature sequence hsa-miR-130b-5p

• Accession: MIMAT0004680
• Previous IDs: hsa-miR-130b*
• Sequence: 13 - acucuuucccuguugcacuac - 33
• Deep sequencing: 95 reads, 13 experiments
• Evidence: experimental; cloned [4-5]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-130b-5p
  • MICRORNA.ORG:hsa-miR-130b-5p
  • MIRDB:hsa-miR-130b-5p
  • RNA22-HSA:hsa-miR-130b-5p
  • TARGETMINER:hsa-miR-130b-5p
  • PICTAR-VERT:hsa-miR-130b

Mature sequence hsa-miR-130b-3p

• Accession: MIMAT0000691
• Previous IDs: hsa-miR-130b
• Sequence: 51 - cagugcaaugaugaaagggcau - 72
• Deep sequencing: 8656 reads, 30 experiments
• Evidence: experimental; cloned [3-5]
• Validated targets:
  • TARBASE:hsa-miR-130b-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-130b-3p
  • MICRORNA.ORG:hsa-miR-130b-3p
  • MIRDB:hsa-miR-130b-3p
  • RNA22-HSA:hsa-miR-130b-3p
  • TARGETMINER:hsa-miR-130b-3p
  • TARGETSCAN-VERT:hsa-miR-130b
  • PICTAR-VERT:hsa-miR-130b

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).