Stem-loop sequence hsa-mir-30e

Accession

MI0000749 (change log)

Symbol

HGNC:MIR30E

Description

Homo sapiens miR-30e stem-loop

Gene family

MIPF0000005; mir-30

Literature search

357 open access papers mention hsa-mir-30e
(1645 sentences)

Stem-loop

   g        uu  ua            uu           g aag u 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
    ||||||||  ||  ||||||||||||  ||||||||||| |   |  
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
   a        --  gc            --           g aga u 

Deep sequencing

7371458 reads, 1.07e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 40754355-40754446 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000015766 ; ZMPSTE24-001; intron 8

  ENST00000372759 ; ZMPSTE24-001; intron 8

Clustered miRNAs

< 10kb from hsa-mir-30e

• hsa-mir-30e: chr1: 40754355-40754446 [+]
• hsa-mir-30c-1: chr1: 40757284-40757372 [+]

Database links

• EntrezGene:MIR30E
• HGNC:MIR30E
• RNAcentral:URS000075C4DE_9606
• miRBase Tracker:MI0000749

Mature sequence hsa-miR-30e-5p

• Accession: MIMAT0000692
• Previous IDs: hsa-miR-30e-5p;hsa-miR-30e
• Sequence: 17 - uguaaacauccuugacuggaag - 38
• Deep sequencing: 6647321 reads, 159 experiments
• Evidence: experimental; cloned [3,5-6]
• Database links:
  • RNAcentral:URS00001DE669_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30e-5p
  • TargetScanVert:hsa-miR-30e-5p
  • miRDB:hsa-miR-30e-5p
  • microrna.org:hsa-miR-30e-5p

Mature sequence hsa-miR-30e-3p

• Accession: MIMAT0000693
• Previous IDs: hsa-miR-30e-3p;hsa-miR-30e*
• Sequence: 59 - cuuucagucggauguuuacagc - 80
• Deep sequencing: 723906 reads, 159 experiments
• Evidence: experimental; cloned [3,5]
• Database links:
  • RNAcentral:URS00004DC6A5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30e-3p
  • TargetScanVert:hsa-miR-30e-3p
  • miRDB:hsa-miR-30e-3p
  • microrna.org:hsa-miR-30e-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).