![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-30e |
||||||
Accession | MI0000749 (change log) | |||||
Symbol | HGNC:MIR30E | |||||
Description | Homo sapiens miR-30e stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
![]()
357 open access papers mention hsa-mir-30e | |||||
Stem-loop |
g uu ua uu g aag u 5' ggcagucu gc cuguaaacaucc gacuggaagcu u g g |||||||| || |||||||||||| ||||||||||| | | 3' ccgucgga cg gacauuuguagg cugacuuucga g c u a -- gc -- g aga u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-30e-5p |
|
Accession | MIMAT0000692 |
Previous IDs | hsa-miR-30e-5p;hsa-miR-30e |
Sequence |
17 - uguaaacauccuugacuggaag - 38 |
Deep sequencing | 6647321 reads, 159 experiments |
Evidence | experimental; cloned [3,5-6] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-30e-3p |
|
Accession | MIMAT0000693 |
Previous IDs | hsa-miR-30e-3p;hsa-miR-30e* |
Sequence |
59 - cuuucagucggauguuuacagc - 80 |
Deep sequencing | 723906 reads, 159 experiments |
Evidence | experimental; cloned [3,5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
4 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|