Stem-loop sequence hsa-mir-26a-2

Accession

MI0000750 (change log)

Symbol

HGNC:MIR26A2

Description

Homo sapiens miR-26a-2 stem-loop

Gene family

MIPF0000043; mir-26

Literature search

425 open access papers mention hsa-mir-26a-2
(1780 sentences)

Stem-loop

         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          aguguc 

Deep sequencing

15326338 reads, 3.65e+04 reads per million, 160 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-26a was cloned from HeLa cells [1]. Two predicted hairpin precursor sequences are present on chromosome 3 (MI0000083) and 12 (MI0000750), each with homologues in mouse (MI0000573 and MI0000706). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr12: 57824609-57824692 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000326570 ; R3HDM2-001; 5'UTR (exon 1)

  OTTHUMT00000326572 ; R3HDM2-003; 5'UTR (exon 1)

  ENST00000347140 ; R3HDM2-001; 5'UTR (exon 1)

  ENST00000402412 ; R3HDM2-003; 5'UTR (exon 1)

Database links

• EntrezGene:MIR26A2
• HGNC:MIR26A2
• RNAcentral:URS000075C1BF_9606
• miRBase Tracker:MI0000750

Mature sequence hsa-miR-26a-5p

• Accession: MIMAT0000082
• Previous IDs: hsa-miR-26a
• Sequence: 14 - uucaaguaauccaggauaggcu - 35
• Deep sequencing: 28542742 reads, 159 experiments
• Evidence: experimental; cloned [2,4-7], Northern [3]
• Database links:
  • RNAcentral:URS000019B0F7_9606
• Predicted targets:
  • TargetMiner:hsa-miR-26a-5p
  • TargetScanVert:hsa-miR-26a-5p
  • miRDB:hsa-miR-26a-5p
  • microrna.org:hsa-miR-26a-5p

Mature sequence hsa-miR-26a-2-3p

• Accession: MIMAT0004681
• Previous IDs: hsa-miR-26a-2*
• Sequence: 52 - ccuauucuugauuacuuguuuc - 73
• Deep sequencing: 3492 reads, 142 experiments
• Evidence: experimental; cloned [6]
• Database links:
  • RNAcentral:URS000015D23B_9606
• Predicted targets:
  • TargetMiner:hsa-miR-26a-2-3p
  • TargetScanVert:hsa-miR-26a-2-3p
  • miRDB:hsa-miR-26a-2-3p
  • microrna.org:hsa-miR-26a-2-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).