Stem-loop sequence hsa-mir-26a-2

AccessionMI0000750 (change log)
Symbol HGNC:MIR26A2
DescriptionHomo sapiens miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Literature search

425 open access papers mention hsa-mir-26a-2
(1780 sentences)

Stem-loop
         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          aguguc 
Get sequence
Deep sequencing
15326338 reads, 3.65e+04 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-26a was cloned from HeLa cells [1]. Two predicted hairpin precursor sequences are present on chromosome 3 (MI0000083) and 12 (MI0000750), each with homologues in mouse (MI0000573 and MI0000706). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 57824609-57824692 [-]
sense
OTTHUMT00000326570 ; R3HDM2-001; 5'UTR (exon 1)
OTTHUMT00000326572 ; R3HDM2-003; 5'UTR (exon 1)
ENST00000347140 ; R3HDM2-001; 5'UTR (exon 1)
ENST00000402412 ; R3HDM2-003; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-26a-5p

Accession MIMAT0000082
Previous IDshsa-miR-26a
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing28542742 reads, 159 experiments
Evidence experimental; cloned [2,4-7], Northern [3]
Database links
Predicted targets

Mature sequence hsa-miR-26a-2-3p

Accession MIMAT0004681
Previous IDshsa-miR-26a-2*
Sequence

52 - 

ccuauucuugauuacuuguuuc

 - 73

Get sequence
Deep sequencing3492 reads, 142 experiments
Evidence experimental; cloned [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).