Stem-loop sequence cel-mir-355

AccessionMI0000754 (change log)
DescriptionCaenorhabditis elegans miR-355 stem-loop
Gene family MIPF0000236; mir-355
Literature search

2 open access papers mention cel-mir-355
(22 sentences)

Stem-loop
   -----aauaa      ---ga     a    u         -cu        ---ag  a 
5'           ugucaa     auuga uggu uguuuuagc   gagcuaug     uc u
             ||||||     ||||| |||| |||||||||   ||||||||     ||  
3'           gcaguu     uaacu accg acaaaaucg   uucgauac     ag c
   aguuuuugaa      aauuc     a    u         uuc        guaua  g 
Get sequence
Deep sequencing
4040 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The 5' end of the mature sequence was mapped by PCR, and the 3' end confirmed later [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11833536-11833645 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-355
cel-mir-8188chrII: 11840444-11840500 [-]
cel-mir-355chrII: 11833536-11833645 [-]
Database links

Mature sequence cel-miR-355-5p

Accession MIMAT0000697
Previous IDscel-miR-355
Sequence

23 - 

uuuguuuuagccugagcuaug

 - 43

Get sequence
Deep sequencing4024 reads, 13 experiments
Evidence experimental; cloned [1-2], PCR [1], Illumina [3]
Database links
Predicted targets

Mature sequence cel-miR-355-3p

Accession MIMAT0031895
Sequence

61 - 

uagcuucuugcuaaaacaugcc

 - 82

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence not experimental

References

1
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3