Stem-loop sequence cel-mir-356a

AccessionMI0000755 (change log)
Previous IDscel-mir-356
DescriptionCaenorhabditis elegans miR-356 stem-loop
Gene family MIPF0001209; mir-356
Literature search

2 open access papers mention cel-mir-356a
(3 sentences)

Stem-loop 
   -uaaaguu    ugag   a       u   ca   -  -   a    aucaa  ua 
5'         uccu    aac auguggu gag  acg cg aac aauc     ug  a
           ||||    ||| ||||||| |||  ||| || ||| ||||     ||  a
3'         agga    uug uacacca cuc  ugc gc uug uuag     ac  u
   aagacuuu    -uga   c       -   ug   a  a   c    --gcg  uu
Get sequence
Deep sequencing
9 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing. The 5' end of the mature sequence ws mapped by PCR, but the 3' ends have not been experimentally determined.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 7860147-7860256 [+]
sense
ZK652.2 ; ZK652.2; exon 2
Clustered miRNAs
< 10kb from cel-mir-356a
cel-mir-356achrIII: 7860147-7860256 [+]
cel-mir-356bchrIII: 7860167-7860234 [-]
Database links

Mature sequence cel-miR-356a

Accession MIMAT0000698
Previous IDscel-miR-356
Sequence

26 -  

uugagcaacgcgaacaaauca

 - 46

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1], PCR [1]
Predicted targets

References

1
PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).