Stem-loop sequence cel-mir-360

Accession

MI0000759 (change log)

Description

Caenorhabditis elegans miR-360 stem-loop

Gene family

MIPF0000210; mir-360

Literature search

5 open access papers mention cel-mir-360
(28 sentences)

Stem-loop

   cau   -guu       -au             c  uu          a   gcaa 
5'    ucu    aggaagc   caauguguuguga cg  guuacgguca uuu    a
      |||    |||||||   ||||||||||||| ||  |||||||||| |||     
3'    gga    ucuuuug   guuacauaacacu gc  uaaugccagu aaa    u
   --u   aacc       cuu             u  cc          a   aagu 

Deep sequencing

111 reads, 0 reads per million, 14 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing. The 5' end of the mature sequence ws mapped by PCR, but the 3' ends have not been experimentally determined.

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrX: 5919149-5919258 [+]
• Overlapping transcripts:

  sense

  Y23B4A.5 ; Y23B4A.5; exon 1

Database links

• RNAcentral:URS0000044515_6239
• miRBase Tracker:MI0000759

Mature sequence cel-miR-360-5p

• Accession: MIMAT0015121
• Previous IDs: cel-miR-360*
• Sequence: 26 - uugugaccguuguuacgguca - 46
• Deep sequencing: 95 reads, 11 experiments
• Evidence: experimental; CLIPseq [3]
• Database links:
  • RNAcentral:URS000023CB32_6239
• Predicted targets:
  • microrna.org:cel-miR-360-5p

Mature sequence cel-miR-360-3p

• Accession: MIMAT0000702
• Previous IDs: cel-miR-360
• Sequence: 65 - ugaccguaaucccguucacaa - 85
• Deep sequencing: 13 reads, 9 experiments
• Evidence: experimental; cloned [1], PCR [1], Illumina [2], CLIPseq [3]
• Predicted targets:
  • TargetScanWorm:cel-miR-360
  • microrna.org:cel-miR-360-3p

References

1. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
3. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).