Stem-loop sequence cel-mir-360

AccessionMI0000759 (change log)
DescriptionCaenorhabditis elegans miR-360 stem-loop
Gene family MIPF0000210; mir-360
Literature search

5 open access papers mention cel-mir-360
(28 sentences)

Stem-loop
   cau   -guu       -au             c  uu          a   gcaa 
5'    ucu    aggaagc   caauguguuguga cg  guuacgguca uuu    a
      |||    |||||||   ||||||||||||| ||  |||||||||| |||     
3'    gga    ucuuuug   guuacauaacacu gc  uaaugccagu aaa    u
   --u   aacc       cuu             u  cc          a   aagu 
Get sequence
Deep sequencing
111 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing. The 5' end of the mature sequence ws mapped by PCR, but the 3' ends have not been experimentally determined.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 5919149-5919258 [+]
sense
Y23B4A.5 ; Y23B4A.5; exon 1
Database links

Mature sequence cel-miR-360-5p

Accession MIMAT0015121
Previous IDscel-miR-360*
Sequence

26 - 

uugugaccguuguuacgguca

 - 46

Get sequence
Deep sequencing95 reads, 11 experiments
Evidence experimental; CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-360-3p

Accession MIMAT0000702
Previous IDscel-miR-360
Sequence

65 - 

ugaccguaaucccguucacaa

 - 85

Get sequence
Deep sequencing13 reads, 9 experiments
Evidence experimental; cloned [1], PCR [1], Illumina [2], CLIPseq [3]
Predicted targets

References

1
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).