Stem-loop sequence mmu-mir-362

Accession

MI0000763

Symbol

MGI:Mir362

Description

Mus musculus miR-362 stem-loop

Gene family

MIPF0000209; mir-362

Stem-loop

cuc           acc        aa   u  u 
   gaauccuugga   uaggugug  ugc gc u
   |||||||||||   ||||||||  ||| ||  
   cuuaggaacuu   guccacac  acg ug c
aaa           ---        -a   -  a 

Deep sequencing

53032 reads, 96 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38): chrX: 7241982-7242046 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000039775 ; Clcn5-003; intron 2

  OTTMUST00000039777 ; Clcn5-005; intron 3

  OTTMUST00000039776 ; Clcn5-004; intron 3

  ENSMUST00000128319 ; Clcn5-003; intron 2

  ENSMUST00000132126 ; Clcn5-005; intron 3

  ENSMUST00000115746 ; Clcn5-004; intron 3

Clustered miRNAs

< 10kb from mmu-mir-362

• mmu-mir-532: chrX: 7248402-7248497 [-]
• mmu-mir-188: chrX: 7247989-7248056 [-]
• mmu-mir-362: chrX: 7241982-7242046 [-]
• mmu-mir-501: chrX: 7241243-7241351 [-]
• mmu-mir-500: chrX: 7237683-7237774 [-]

Database links

• ENTREZGENE: 723851;Mir362
• MGI: 3619369;Mir362

Mature sequence mmu-miR-362-5p

• Accession: MIMAT0000706
• Previous IDs: mmu-miR-362
• Sequence: 5 - aauccuuggaaccuaggugugaau - 28
• Deep sequencing: 16347 reads, 81 experiments
• Evidence: experimental; cloned [1,3], MPSS [2], Solexa [4-5]
• Validated targets:
  • TARBASE:mmu-miR-362-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-362-5p
  • MICRORNA.ORG:mmu-miR-362-5p
  • MIRDB:mmu-miR-362-5p
  • RNA22-MMU:mmu-miR-362-5p
  • TARGETSCAN-VERT:mmu-miR-362-5p

Mature sequence mmu-miR-362-3p

• Accession: MIMAT0004684
• Sequence: 42 - aacacaccuguucaaggauuca - 63
• Deep sequencing: 20384 reads, 81 experiments
• Evidence: experimental; cloned [3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-362-3p
  • MICRORNA.ORG:mmu-miR-362-3p
  • MIRDB:mmu-miR-362-3p
  • RNA22-MMU:mmu-miR-362-3p
  • TARGETSCAN-VERT:mmu-miR-362-3p

References

1. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).