![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-365b |
||||||
Accession | MI0000769 (change log) | |||||
Previous IDs | hsa-mir-365-2 | |||||
Symbol | HGNC:MIR365B | |||||
Description | Homo sapiens miR-365b stem-loop | |||||
Gene family | MIPF0000061; mir-365 | |||||
Literature search |
![]()
61 open access papers mention hsa-mir-365b | |||||
Stem-loop |
agaguguucaa g -- a ac c ----- u u 5' g aca gcaagaa aaugaggg uuu aggggca gcug guu u | ||| ||||||| |||||||| ||| ||||||| |||| ||| 3' c ugu cguucuu uuauuccu aaa uccccgu ugac cag c -----gggcua g ga g aa - aauac u u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486). |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-365b-5p |
|
Accession | MIMAT0022833 |
Sequence |
29 - agggacuuucaggggcagcugu - 50 |
Deep sequencing | 7975 reads, 110 experiments |
Evidence | experimental; 454 [5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-365b-3p |
|
Accession | MIMAT0022834 |
Sequence |
68 - uaaugccccuaaaaauccuuau - 89 |
Deep sequencing | 222462 reads, 159 experiments |
Evidence | experimental; cloned [1,3-4], array-cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
5 |
PMID:19144710
"Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
J Virol. 83:3333-3341(2009).
|