Stem-loop sequence hsa-mir-365b

Accession

MI0000769 (change log)

Previous IDs

hsa-mir-365-2

Symbol

HGNC:MIR365B

Description

Homo sapiens miR-365b stem-loop

Gene family

MIPF0000061; mir-365

Literature search

61 open access papers mention hsa-mir-365b
(315 sentences)

Stem-loop

   agaguguucaa g   --       a        ac   c       -----    u   u 
5'            g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu u
              | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
3'            c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
   -----gggcua g   ga       g        aa   -       aauac    u   u 

Deep sequencing

230531 reads, 1.03e+03 reads per million, 160 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486).

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 31575411-31575521 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000256378 ; ASIC2-001; intron 1

  OTTHUMT00000447552 ; ASIC2-003; intron 1

  OTTHUMT00000447553 ; ASIC2-004; intron 1

  OTTHUMT00000256379 ; ASIC2-002; intron 2

  ENST00000225823 ; ASIC2-001; intron 1

  ENST00000359872 ; ASIC2-003; intron 1

  ENST00000579816 ; ASIC2-004; intron 1

  ENST00000448983 ; ASIC2-002; intron 2

Clustered miRNAs

< 10kb from hsa-mir-365b

• hsa-mir-4725: chr17: 31575269-31575358 [+]
• hsa-mir-365b: chr17: 31575411-31575521 [+]

Database links

• EntrezGene:MIR365-2
• HGNC:MIR365B
• RNAcentral:URS000075E397_9606
• miRBase Tracker:MI0000769

Mature sequence hsa-miR-365b-5p

• Accession: MIMAT0022833
• Sequence: 29 - agggacuuucaggggcagcugu - 50
• Deep sequencing: 7975 reads, 110 experiments
• Evidence: experimental; 454 [5]
• Database links:
  • RNAcentral:URS00003E2232_9606
• Predicted targets:
  • TargetMiner:hsa-miR-365b-5p
  • TargetScanVert:hsa-miR-365b-5p
  • miRDB:hsa-miR-365b-5p

Mature sequence hsa-miR-365b-3p

• Accession: MIMAT0022834
• Sequence: 68 - uaaugccccuaaaaauccuuau - 89
• Deep sequencing: 222462 reads, 159 experiments
• Evidence: experimental; cloned [1,3-4], array-cloned [2]
• Database links:
  • RNAcentral:URS00003E7283_9606
• Predicted targets:
  • TargetMiner:hsa-miR-365b-3p
  • TargetScanVert:hsa-miR-365b-3p
  • miRDB:hsa-miR-365b-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).