|
miRBase |
|
Stem-loop sequence hsa-mir-369 |
|||||
| Accession | MI0000777 | ||||
| Symbol | HGNC:MIR369 | ||||
| Description | Homo sapiens miR-369 stem-loop | ||||
| Gene family | MIPF0000018; mir-154 | ||||
| Stem-loop |
u ag ua cuuua uga ggagaucgaccgugu uauucg u ||| ||||||||||||||| |||||| acu uuucuaguugguaca auaagc u g cu ua uucag |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-369-5p |
|
| Accession | MIMAT0001621 |
| Sequence |
9 - agaucgaccguguuauauucgc - 30 |
| Deep sequencing | 85 reads, 7 experiments |
| Evidence | experimental; cloned [2-4] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-369-3p |
|
| Accession | MIMAT0000721 |
| Previous IDs | hsa-miR-369 |
| Sequence |
44 - aauaauacaugguugaucuuu - 64 |
| Deep sequencing | 93 reads, 7 experiments |
| Evidence | experimental; cloned [1-4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
| 2 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|