![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-377 |
||||||||||||||||||||||||||||||||
Accession | MI0000785 (change log) | |||||||||||||||||||||||||||||||
Symbol | HGNC:MIR377 | |||||||||||||||||||||||||||||||
Description | Homo sapiens miR-377 stem-loop | |||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||
Literature search |
![]()
65 open access papers mention hsa-mir-377 | |||||||||||||||||||||||||||||||
Stem-loop |
uu c - a - uuu 5' gagcagagguugcc uug guga uucg c a |||||||||||||| ||| |||| |||| | u 3' uuuguuuucaacgg aac cacu aagu g u -g a a - u uau |
|||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-377-5p |
|
Accession | MIMAT0004689 |
Previous IDs | hsa-miR-377* |
Sequence |
7 - agagguugcccuuggugaauuc - 28 |
Deep sequencing | 1215 reads, 101 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-377-3p |
|
Accession | MIMAT0000730 |
Previous IDs | hsa-miR-377 |
Sequence |
45 - aucacacaaaggcaacuuuugu - 66 |
Deep sequencing | 4424 reads, 124 experiments |
Evidence | experimental; cloned [1-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|