![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-379 |
||||||||||||||||||||||||||
Accession | MI0000787 (change log) | |||||||||||||||||||||||||
Symbol | HGNC:MIR379 | |||||||||||||||||||||||||
Description | Homo sapiens miR-379 stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||
Literature search |
![]()
48 open access papers mention hsa-mir-379 | |||||||||||||||||||||||||
Stem-loop |
a a ga - uu u 5' agag uggu gacuaug acguagg cg a g |||| |||| ||||||| ||||||| || | 3' ucuc auca cugguac uguaucc gu u a a c aa a cu u |
|||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-379-5p |
|
Accession | MIMAT0000733 |
Previous IDs | hsa-miR-379 |
Sequence |
6 - ugguagacuauggaacguagg - 26 |
Deep sequencing | 171993 reads, 122 experiments |
Evidence | experimental; cloned [2-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-379-3p |
|
Accession | MIMAT0004690 |
Previous IDs | hsa-miR-379* |
Sequence |
44 - uauguaacaugguccacuaacu - 65 |
Deep sequencing | 3880 reads, 118 experiments |
Evidence | experimental; cloned [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
2 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|