![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-380 |
||||||||||||||||||||||||||||
Accession | MI0000788 (change log) | |||||||||||||||||||||||||||
Symbol | HGNC:MIR380 | |||||||||||||||||||||||||||
Description | Homo sapiens miR-380 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||||
Literature search |
![]()
13 open access papers mention hsa-mir-380 | |||||||||||||||||||||||||||
Stem-loop |
guu ga c c 5' aagaug gaccaua acaugcg uau u |||||| ||||||| ||||||| ||| 3' uucuac cugguau uguaugc gug c -ac aa u u |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Comments |
Landgraf et al. confirm that the 3' product is the predominant one [3]. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-380-5p |
|
Accession | MIMAT0000734 |
Previous IDs | hsa-miR-380-5p;hsa-miR-380* |
Sequence |
5 - ugguugaccauagaacaugcgc - 26 |
Deep sequencing | 1103 reads, 60 experiments |
Evidence | by similarity; MI0000797 |
Predicted targets |
|
Mature sequence hsa-miR-380-3p |
|
Accession | MIMAT0000735 |
Previous IDs | hsa-miR-380-3p;hsa-miR-380 |
Sequence |
40 - uauguaauaugguccacaucuu - 61 |
Deep sequencing | 377 reads, 50 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
2 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|