![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-382 |
||||||||||||||||||||||||||||||||
Accession | MI0000790 (change log) | |||||||||||||||||||||||||||||||
Symbol | HGNC:MIR382 | |||||||||||||||||||||||||||||||
Description | Homo sapiens miR-382 stem-loop | |||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||
Literature search |
![]()
69 open access papers mention hsa-mir-382 | |||||||||||||||||||||||||||||||
Stem-loop |
u -a ug - uuu 5' uacu gaagaga guuguucgugg gauucg c a |||| ||||||| ||||||||||| |||||| | c 3' auga cuuuuuu caacaggcacu cuaagc g u - ca ua a uau |
|||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-382-5p |
|
Accession | MIMAT0000737 |
Previous IDs | hsa-miR-382 |
Sequence |
11 - gaaguuguucgugguggauucg - 32 |
Deep sequencing | 31012 reads, 120 experiments |
Evidence | experimental; cloned [1-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-382-3p |
|
Accession | MIMAT0022697 |
Sequence |
47 - aaucauucacggacaacacuu - 67 |
Deep sequencing | 5683 reads, 116 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|