Stem-loop sequence mmu-mir-375

Accession

MI0000792 (change log)

Symbol

MGI:Mir375

Description

Mus musculus miR-375 stem-loop

Gene family

MIPF0000114; mir-375

Literature search

113 open access papers mention mmu-mir-375
(1343 sentences)

Stem-loop

   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   c  a    -      cuu  u     u  gag 

Deep sequencing

412610 reads, 1.64e+03 reads per million, 96 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr1: 74900658-74900721 [-]
• Overlapping transcripts:

  sense

  ENSMUST00000083682 ; Mir375-201; exon 1

Database links

• EntrezGene:Mirn375
• MGI:Mir375
• RNAcentral:URS000075BCF9_10090
• miRBase Tracker:MI0000792

Mature sequence mmu-miR-375-5p

• Accession: MIMAT0017078
• Previous IDs: mmu-miR-375*
• Sequence: 5 - gcgacgagccccucgcacaaac - 26
• Deep sequencing: 4 reads, 4 experiments
• Evidence: experimental; Illumina [4]
• Predicted targets:
  • TargetScanVert:mmu-miR-375-5p
  • miRDB:mmu-miR-375-5p

Mature sequence mmu-miR-375-3p

• Accession: MIMAT0000739
• Previous IDs: mmu-miR-375
• Sequence: 40 - uuuguucguucggcucgcguga - 61
• Deep sequencing: 412606 reads, 96 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00000ED600_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-375-3p
  • miRDB:mmu-miR-375-3p
  • microrna.org:mmu-miR-375-3p

References

1. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).