![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-375 |
|||||
Accession | MI0000792 (change log) | ||||
Symbol | MGI:Mir375 | ||||
Description | Mus musculus miR-375 stem-loop | ||||
Gene family | MIPF0000114; mir-375 | ||||
Literature search |
![]()
113 open access papers mention mmu-mir-375 | ||||
Stem-loop |
c - a ccu c c gac 5' cc cgcg cgagcc cg acaaa cg c || |||| |||||| || ||||| || 3' gg gugc gcucgg gc uguuu gc u c a - cuu u u gag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-375-5p |
|
Accession | MIMAT0017078 |
Previous IDs | mmu-miR-375* |
Sequence |
5 - gcgacgagccccucgcacaaac - 26 |
Deep sequencing | 4 reads, 4 experiments |
Evidence | experimental; Illumina [4] |
Predicted targets |
|
Mature sequence mmu-miR-375-3p |
|
Accession | MIMAT0000739 |
Previous IDs | mmu-miR-375 |
Sequence |
40 - uuuguucguucggcucgcguga - 61 |
Deep sequencing | 412606 reads, 96 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|