|
miRBase |
|
Mature sequence mmu-miR-379-5p |
|
| Accession | MIMAT0000743 |
| Previous IDs | mmu-miR-379 |
| Sequence |
6 - ugguagacuauggaacguagg - 26 |
| Deep sequencing | 148557 reads, 67 experiments |
| Evidence | experimental; cloned [1-4], Solexa [5,7] |
| Predicted targets |
|
Mature sequence mmu-miR-379-3p |
|
| Accession | MIMAT0017080 |
| Previous IDs | mmu-miR-379* |
| Sequence |
43 - uauguaacaugguccacuaacu - 64 |
| Deep sequencing | 81674 reads, 57 experiments |
| Evidence | experimental; 454 [6], Solexa [7] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 | |
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|