|
miRBase |
|
Mature sequence mmu-miR-382-5p |
|
| Accession | MIMAT0000747 |
| Previous IDs | mmu-miR-382 |
| Sequence |
11 - gaaguuguucgugguggauucg - 32 |
| Deep sequencing | 56873 reads, 71 experiments |
| Evidence | experimental; cloned [1-3], Solexa [4-5] |
| Predicted targets |
|
Mature sequence mmu-miR-382-3p |
|
| Accession | MIMAT0004691 |
| Previous IDs | mmu-miR-382* |
| Sequence |
49 - ucauucacggacaacacuuuuu - 70 |
| Deep sequencing | 27900 reads, 70 experiments |
| Evidence | experimental; cloned [3], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|