Stem-loop sequence hsa-mir-340

Accession

MI0000802 (change log)

Symbol

HGNC:MIR340

Description

Homo sapiens miR-340 stem-loop

Gene family

MIPF0000191; mir-340

Literature search

75 open access papers mention hsa-mir-340
(421 sentences)

Stem-loop

   --uu     u      au       -caa      u    g     ug 
5'     guacc ggugug  uauaaag    ugagac gauu ucaua  u
       ||||| ||||||  |||||||    |||||| |||| |||||  c
3'     uaugg ccauac  auauuuc    acucug cuag ggugu  g
   auuc     u      cg       auug      c    -     uu 

Deep sequencing

359849 reads, 914 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr5: 180015303-180015397 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR340
• HGNC:MIR340
• RNAcentral:URS000075C604_9606
• miRBase Tracker:MI0000802

Mature sequence hsa-miR-340-5p

• Accession: MIMAT0004692
• Previous IDs: hsa-miR-340
• Sequence: 16 - uuauaaagcaaugagacugauu - 37
• Deep sequencing: 350491 reads, 159 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS0000007FBA_9606
• Predicted targets:
  • TargetMiner:hsa-miR-340-5p
  • TargetScanVert:hsa-miR-340-5p
  • miRDB:hsa-miR-340-5p
  • microrna.org:hsa-miR-340-5p

Mature sequence hsa-miR-340-3p

• Accession: MIMAT0000750
• Previous IDs: hsa-miR-340;hsa-miR-340*
• Sequence: 58 - uccgucucaguuacuuuauagc - 79
• Deep sequencing: 9260 reads, 136 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS000048521E_9606
• Predicted targets:
  • TargetMiner:hsa-miR-340-3p
  • TargetScanVert:hsa-miR-340-3p
  • miRDB:hsa-miR-340-3p
  • microrna.org:hsa-miR-340-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).