miRBase entry: hsa-mir-340

Stem-loop hsa-mir-340


Accession
MI0000802
Symbol
HGNC: MIR340
Description
Homo sapiens hsa-mir-340 precursor miRNA mir-340
Gene
family?
RF00761; mir-340

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR340 is a host microRNA implicated in the regulation of antiviral responses, specifically targeting the antiviral factors RIG-I and OAS2, which are crucial in the host's defense against influenza virus infection [PMC6370596]. The study's findings suggest that MIR340 may play a role in modulating immunity, as its inhibition could potentially enhance the immune response against influenza by reducing the suppression of these key antiviral proteins [PMC6370596]. The identification of MIR340 target sites within the 3สน UTR of RIG-I at positions 1,657 and 1,809 supports the strategy of targeting host miRNAs as a novel therapeutic approach to combat influenza virus infection [PMC6370596]. This approach is consistent with previous reports that miRNA-dependent strategies have been developed for viral infections and that modulating miRNA activity can have a significant impact on viral resistance, as seen with miR144-deficient mice and their resistance to influenza virus [PMC6370596].

Literature search
75 open access papers mention hsa-mir-340
(422 sentences)

Sequence

271302 reads, 937 reads per million, 133 experiments
uuguaccuggugugaUUAUAAAGCAAUGAGACUGAUUgucauaugucguuugugggaUCCGUCUCAGUUACUUUAUAGCcauaccugguaucuua
..(((((.((((((.((((((((...((((((.((((.(((((.......))))))))).))))))....)))))))).)))))).)))))....

Structure
--uu     u      a        -CAA      U    g     ug 
    guacc ggugug UUAUAAAG    UGAGAC GAUU ucaua  u
    ||||| |||||| ||||||||    |||||| |||| |||||  c
    uaugg ccauac GAUAUUUC    ACUCUG CUag ggugu  g
auuc     u      C        AUUG      C    -     uu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr5: 180015303-180015397 [-]

Disease association
hsa-mir-340 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-340-5p

Accession MIMAT0004692
Description Homo sapiens hsa-miR-340-5p mature miRNA
Sequence 16 - UUAUAAAGCAAUGAGACUGAUU - 37
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-340-3p

Accession MIMAT0000750
Description Homo sapiens hsa-miR-340-3p mature miRNA
Sequence 58 - UCCGUCUCAGUUACUUUAUAGC - 79
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365