![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-340 |
|||||
Accession | MI0000802 (change log) | ||||
Symbol | HGNC:MIR340 | ||||
Description | Homo sapiens miR-340 stem-loop | ||||
Gene family | MIPF0000191; mir-340 | ||||
Literature search |
![]()
75 open access papers mention hsa-mir-340 | ||||
Stem-loop |
--uu u au -caa u g ug 5' guacc ggugug uauaaag ugagac gauu ucaua u ||||| |||||| ||||||| |||||| |||| ||||| c 3' uaugg ccauac auauuuc acucug cuag ggugu g auuc u cg auug c - uu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-340-5p |
|
Accession | MIMAT0004692 |
Previous IDs | hsa-miR-340 |
Sequence |
16 - uuauaaagcaaugagacugauu - 37 |
Deep sequencing | 350491 reads, 159 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-340-3p |
|
Accession | MIMAT0000750 |
Previous IDs | hsa-miR-340;hsa-miR-340* |
Sequence |
58 - uccgucucaguuacuuuauagc - 79 |
Deep sequencing | 9260 reads, 136 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|