MIR337 is a microRNA (miRNA) implicated in various biological processes and diseases, including head and neck cancers, although it was not detected in a specific study on these cancers [PMC5354851]. It exhibits differential expression patterns based on sex, being down-regulated in males and up-regulated in females [PMC7663125]. This miRNA is part of the Dlk1-Dio3 imprinted domain and is transcribed from the maternal chromosome [PMC3919614]. In the context of esophageal cancer, over-expression of MIR337 has been shown to significantly increase autophagy, as indicated by the conversion of LC3-I to LC3-II [PMC5302951]. However, its expression was significantly decreased in another study focusing on miRNAs, leading to it not being further examined by quantitative RT-PCR (qRT-PCR) [PMC4748271]. Additionally, MIR337 plays a role in controlling chondrogenesis of mesenchymal stem cells (MSCs) and the progression of osteoarthritis (OA) [PMC10110697].
guagucaguaguu - C U C - ca ggggggugg GAA GGC UCAUA AGGAGUUg aug c ||||||||| ||| ||| ||||| |||||||| ||| uccccuaCU CUU CCG AGUAU UCCUCgac uau a ---------aacu U U U A c ug
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004695 |
Description | Homo sapiens hsa-miR-337-5p mature miRNA |
Sequence | 23 - GAACGGCUUCAUACAGGAGUU - 43 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000754 |
Description | Homo sapiens hsa-miR-337-3p mature miRNA |
Sequence | 61 - CUCCUAUAUGAUGCCUUUCUUC - 82 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|