![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-323a |
||||||||||||||||||||||||||||
Accession | MI0000807 (change log) | |||||||||||||||||||||||||||
Previous IDs | hsa-mir-323 | |||||||||||||||||||||||||||
Symbol | HGNC:MIR323A | |||||||||||||||||||||||||||
Description | Homo sapiens miR-323a stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||
Literature search |
![]()
45 open access papers mention hsa-mir-323a | |||||||||||||||||||||||||||
Stem-loop |
---uu u g g u gcgc u uua 5' gguacu g agagaggu g ccgug gu cgcu u |||||| | |||||||| | ||||| || |||| 3' cuauga c uuucucca c ggcac ca gcgg u cuaau - g g u auua c uau |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Comments |
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-323a-5p |
|
Accession | MIMAT0004696 |
Previous IDs | hsa-miR-323-5p |
Sequence |
16 - aggugguccguggcgcguucgc - 37 |
Deep sequencing | 603 reads, 28 experiments |
Evidence | experimental; cloned [3] |
Predicted targets |
|
Mature sequence hsa-miR-323a-3p |
|
Accession | MIMAT0000755 |
Previous IDs | hsa-miR-323;hsa-miR-323-3p |
Sequence |
51 - cacauuacacggucgaccucu - 71 |
Deep sequencing | 3109 reads, 112 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|